Ornithorhynchus_anatinus Locus Mono:SNORA7
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SNORA7
Ornithorhynchus_anatinus
Mono:SNORA7
Contig96941
SNORA7
596..733
1030
CCACATGGGGCTTACCGTCTTCCCATTTTATGGATGAGAGCAATACGAAGGAGACAGAG
AACTAAAGTGAATTGCCCAAGGTCACTCTCAGACAAGTGGCAGAGCCGGGATTAGAGCCC
AGGTCCTTCTGACTTCCAGGCCCATGCTCTATCCTTAGGCCACACAACTTTTCAATTTAG
CGATGTTCTTATTTGCTGTGTCTGAAGCTGCTCTTCCGGGTCATTAATTTAGTCTTTAGT
CCTGTTCATGATGGAGAATAAGGTGGGAAGCTAAGCACGTTGTCTGCCTTTGCTCTTCTA
GGTAGTCAAAATGGCCCTTTTACCAGTGCCAATTGTTCCCTGAAGAAATTCCCATGTTTC
ATCAGGAAATGGTGCCCTCCCTTTGATCCATGTTCCCACAAATACCAGCTCAATCTACTG
TGTCTCATGAAATAATAGCCTACCACAATCAATCAATCAGTGGTATTTATTGAGCGCTTT
CTGTGTGCAAGTATTCTTGTGAGAGTCCAATACAACAGAGTAGATAATGAACTCACTGTC
TAGAGGGAGAGATAGACATTAATATAAATAAATAAATTATGGATATGTACAGATGCCCCC
TCTCAGAATGACACCTGGAGAGTTTCCAGTACTCTACTGATCTCTGCTACGGGAGGGAGA
GTGAAGCAGAAGCATACCCATTCCATTCCTAGCATGGGCAGTGGCTAGCGAGTGGAAGGC
AATCTGCTACAAGTCAAAACCTGTGCTGGGTAGCAGAGGCACGGGAGAGAGTCGAGGGTG
GAGACTCCAGTTTACTGTGCAGAAGAAGGCAGTGGAAAAATCAATTCTGTATTTTGATCA
AGAAAACTCGATCCACTACCAGAATAATTGCAGATGGAGGTGGGGCATTCTGGGGAGAGA
TGTGTCCTTGGTGTCGCTATGGGTGGGAGACAACCTAGCATAAGACAAGACAGTGTGCTG
AGGGGCTGAGGGTGGGCTGAATATCAATTGCCCAAAGGGTACAGATCCAAATGCATAGAT
GAGCAGAAAGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved