Ornithorhynchus_anatinus Locus Mono:SNORD24
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SNORD24
Ornithorhynchus_anatinus
Mono:SNORD24
Contig93341
SNORD24
696..772
787
CCCGAGCCCTCAACGGCCGACAAGATCAGTCGTTGGTCTGTGAAGCCCGTCACTGGCGA
GGATGGTCTCTAGCTGTTGCCGAATTGGACATCCCAAGCGCTTAGTACAGTGCTCTGCGC
ATAGTAAGCACTCAGTAAATACTATTGAACAGGATGCAGAGGTGGGATCGGAACCCAGGT
CCCCCGACTCCAAGGCCCGTGTCCTCTCCGCTAGGCCACGCTGCTTCTCTACCGGTTTCC
GAGTCTTGGAGCGCTCGACGGAGGCGCGGGGCAGGAGGAGCGGGATGGAGCCCGGAGACT
CAATTGTGCCCTTCCCTCTCTTTCAGCCGAAGGGAAAGAAGATCAAGGGGAAGAAGGTGG
CCCCGGCCCCCGCCGTGGTGAAGAAGCCGGAGGTCAAGAAAGTGGTCAACCCCTTGTTCG
AGAAGCGGCCCAAGAACTTTGGCATCGGTGAGGGGGAGTTGGGCGGGGGGGCAGGGCTGG
CGGGGGGGCAGCCGTTTCGTTGGGATGGTAATAACGTGTTACACGAACAGCTCTTCGTCA
GGGAACTCTTCCACTGGCCTCCCTGCCGTCCGCTGGTTGCCTTTGTGCCGTTCCCCGGGG
CAGTTAGTGGATTACGTTTTGCCCAGGGAGGCGCTTGCTGATATTCCATCTGGGTTGTGG
CGGGGGGGGAGGGGGACACCGAGCTACCCCCGCCGGTGCAGATGATGCAAAAGAACATCC
GCTGTCAGAATGGTCGTGGTGACACGTCGCTAACCACCAAGATCGCTGATGCACGCTTCT
CCACACTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved