Ornithorhynchus_anatinus Locus ENSOANG00000004669
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus ENSOANG00000004669
Ornithorhynchus_anatinus
ENSOANG00000004669
Contig9329
SNORD21, SNORA66, SNORA66
6459..6554, 7890..8024, 10454..10585
12397
TAAGCTGTGAGCCCATCACTGGGCAGGGATGGCCTCTATCTGTTAGCCAAGTGTCCATT
CCAAACGCTTAGTCCAGTGCTCTGCAGACAGTAAGCGCTCAATAAATACGATCGAATGAA
TGGTGAATGAATGTTTAGACTGTGAACCTGTCGTCGGGCAGGGATGGCCTCTATCTTTTA
GTCAAGTGTCCATTCCAAGTGCTTAGTCCAGCGCTCTGCACACATTAATCGCTCAATAAA
TACGATCGAATGAATGGTGAATGAATGTTTAGACTGTGAACCCGTCGTTGGGCAGGGATG
GCCTCTCTCTGTTGCCGAATTGTCCATTCCAAGCGCTTCGTCCAGTGCTCTGCACCTAGT
AAGCACTCAAGAAATACTATTGAATGAATTGAATGAATGTTTGGACTGAGAGCCCGTCAT
TGGGCAAGGATGGCCTCTAACTGTTACCCAATCGTCCACTCCAAGCGCTTAGTCCAGTGC
TCTGCACACAAGAGAAGCAGCATGGCTCAGTGGAAAGAGCACGGGCTTTGGAGTCAGAGG
TCATGGGTTCGAATCCCAGCTCCGCCACTTGTCAGCTGTGTGACTGTGGGCAAGTCACTT
CACTTCTCTGTGCCTCAGTTACCTCATCTGTAAAATGGGGATTAAGACTGTGAGCCCCAC
GTGGGACAGATTCCCCTGTGTCTACCCCAGCGCTTAGAACAGTGCTCGGCATATAGTAAG
CGCTTAACAAATACCAACATTATTAAGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCCCTTTTCTTTCCCCCCCATCGCGGCGG
AGGCTCCGCTGCCCTCCGCTGCGCCGCTTTGGCGGTCCTCCCCCGGCCGAGATGGTGAGT
GACCCTCCACCCCGACCCCTCCCGGACGGAAGGGCCACCCCTCGTCCTCCCCGCCATGGC
GTCCGGAGGCCGGCGGGCGGCTCCTCGGGGACGGATGGCGCTGGATTGCGGGAGCGGCGG
GCGGGCGGCCATCGGCGTGGCCTAATGGCTGCCGGCGGCGGGGACCGGCCGAGGGCGTGG
AGGGGGGGAAGGGGCGGCATCGGGCCGCCATCCCACCCACCCTCCGCTCGCCACCCGCCC
CAGGCTTTCCGCAAAAATCGGGGGGATCTCCGGACCTCCTTTTGGGGTGTCGGGGGGCGG
GGGAGGGATGGGCAGGTCCTGGGCCCAGCGTGCAGCAGACAGTTGCACCTCCCCAGGAAG
GTGCAGCCGGACTTTGCTAATCATCCTCATCGATAGCATTTCTTAAGCGCCCACTATGTG
CCTTGGTTCAAATCCCTGCTCCGCCGCTTGTCATTCATCCAGTCGTATTTGTTGGGCCCT
TGCTCTGTGCAGAGCACTGGGCGAAGCGCTGGGAAGGGACAGTAATAATGATAATGTTGG
TATTCGTTAAGCGCTTACTATGTGCCGAGCGCTGCCCTAAGCGCTGGGGTAGGCACAGGG
GAATCAGGTTGTCCCACGTGGGGCTCACAGTCTTCATCCCCATTTTACAGATGAGGGAAC
TGAGGCCCCGAGAAGTGAAGTGACTTGCCCACAGTCACCCAGCTGACAAGTGGCAGAGCT
GGGATTTGAACTCATGACCTCTGACTCCAAAGCCCGTGCTCTTTCCACTGAGCCACGCCG
TTTCTCTATAATCATAATCTGTGTAATTATGGCGTTTGCTAAGCGCTTATTAAGGGGAGT
GGTGTGCACACAGTAAGCGCTCAATAAATACCACTGAATGAATGAATGCCAGCTAAGCTG
GTTGGACACGGTCCCTGTCCCACTTGGGGCTCTCCCTCTTAGACCCCAATTTTATAGATG
AGGTCACTGAGGCCCGGAGAAGTGACTTGGCCAAGGTTCCACAGTAGGTAAGAGGCAGGG
CTGGGATTAGAACCCACGACCTTCTGACACCTGGGCTCGATCCACTACACCATGCTCTTT
TTCAGTCATATTTATTGCTTGCAGAGTACCAAGCAATTGGGAGGCTACACTAGGATAAAA
CAGACACATTCCTGCCCACAATAATAACGATAATGGTGCTATTTGTTAAGCGCTTCCTAT
ATGCCAAGCACTGATCTAAGCAAAGGGGTAGATAAAAGGTATTCAGGTGGTCCCATATGG
GGCTCACAGTCCTCATCCCCGTTTTACAGATGAGGTAACTGAGACACAGAGAAGTGAAGT
GGCGTGCCCAGGGCCACACAGCAGACAAGTGGCAGAGTTGGGATTAGAACCCACGTCCTC
AGACTGCCAAGCCTGGGCTCTTGCCACACTAGATCCCAGTCTAGAGTTGGTGCTCCTTGC
TGCCCCGGCCCTTTCCCTGGGGTTTCCTCCTTGGGTGGGCGAGGGACCCCCGGGGGTCCA
GGCCGCGTTGGGGAAGGATTTGGCCAAAGTGGGGTCTTCTCCCAGCAGGCCCAGGCCATG
GGTGGGGATATTAGAGGGCCACCCCTGGTGTTTCTCGCACTCCGCTCCCTGGAGCCGGGA
CCCCGGGCTGGGCGTTTGGGGGGTGCGTGTCTGTGTGTCAACTGTGAACAGTAAATTGGT
TATTTACCTCTGCCTCCCTCCTACTCTAAGCTCATTGTGAGCAGGGAATGCATCGACTCA
GTTATAATGGATTCACCCAAGCGCTTAGTAGAGTGCCCCGCACACAGGAAGCGTTCAGCA
AATACCATTGATGGGTCGACTTCGGCACTAAAGCGATGCAGACGAACAGAAGTGACTTGG
GTGTTGCACAGATGGGCCTGGTCTGCTAAAGTCGGCTCAGGTGATGCATATTTAAAGCTG
CCCAGGGCTCTTGGTGGAGCTGGCGTGACGTTTTCCGTTCTGTAATTGGGGTATTAAACG
CTTGCTGTGTGACAGGCACCCAAGTGCTGGGGTAGAAACAAGATAATCCGGTCGTGCGTG
GCGATCTCGGACTAAGTAAGAGGGAGACCAGGTATTGACTCCCCTTTTTGCAGATTAGGG
AACTGGGGCACAGAGAAGTTTGGTGACTTGTTCGAGGTCACACAGCAGGTGTGTGGCGGA
GTTGGGATGAGAAGCCAGGTCCTCTGACTCCCGAGCCCACTCTCCCCTAGGCCATTTATC
GGTTTATTTCCCATCATTTAGTGCGTTCAGTCTCTTCGGTGTGGCTTCGTGGAAAGATCC
TGGGCTTGGGAGTCAGGTCGTAGGTTCTAATCCTAGCTGAGCCACTTATCACCTGTGTGA
CAAGTTATTTCACTTCTGTGCCTCAGTTATCTGGAAAATGGGGATTAAGACCGTGAGCGC
CACGTGGGACAACCTGATATCTAACCCCAGCGCTTAGATCGCTGCTCGGCACATAGTAAG
CGCTTAACAAATACAGTCATTATTATTATCAAATAGTGATTTTCAGGGGAGATGCCGCTT
AGCCCCTCAAGGTCATCCTGTCGGTTTTAACTTGGACAGAATTATGCACCTCGATGGTTG
CTCTAAAGTATTTGTCTCTTCCTTTCAGGGGTTTGTCAAAGTTGTCAAGAATAAAGCCTA
CTTCAAGAGGTATCAAGTGAAATTCAGGAGAAGGCGAGGTACAGTAAGTTTCGGATCTCT
AAGATAAATTGTGTCCTTGCATTGAATCTCGCCTCTTGTAACGTAACCGTTTTCTTTCAC
AGAGGGAAAGACTGATTACTATGCTCGCAAACGCTTAGTAATTCAGGATAAAAACAAGTA
CAACACGCCAAAATACAGGATGATCGTCCGTGTCACCAACAGAGATATCATCTGTCAGGT
AATTCGTGTGTTCTAGTCCCGAGAAATGAAGCCTTGTCTGACTTCTTGGCCTCCTGCTCT
CGTCTAGCTGCTCTTTGACCCAGCGATTGTGACTCGATTTTGGCTCTCCTAATATACGGG
GAGAGCTTTATTAAGGGTTTTTTTTTTTTTTTTTTTAAAGAACTGCACATACTAAATTAA
AGACCCTGGAGTGTTTTAGTGTCATCCTAGTGGTTGATGGTTATGTGTTGTACCAGATCC
ACTTGGTATAGCAAGAGGCTTATGTGAATTGGCCTCCTCATGATGCCTGAGCTCTCCTGA
AAAGAGGGAGGAAGTCAAAGCCCTGCCTACTAGGAATATTGCTTCCAGTTCACAGTCTAA
GGGCTCCGTTTTTCTTCATCCCGGCGTATTACTTTCCTTTCCGGCATCTTGTCTAATGGC
CTGGTACAGAGAGCATCAGCTGATGGCTTGTGTATAGGAGCTGGGGACTTCTTTCTTCCT
TGTGCACAGATTTATCGAATTGCCCAAAGCAGTATGACTGTCAAGATGGCTAATGATTAT
CGTATGGACATGTGTATTGAGTGTCTGTTTTCTTGTAAGGCAGTGCTTCACTGGAGCCTT
ACTGGTTCCACTTACTTAGCTCCCACCACTTTCTCAGAATAATAATGATAATAAAAATAA
TATACCTGCTGTACTCGTTGCACATTCTTCCATAAAACCTTACTTTAGTAGCTAATGTTC
ATTTTTTCCCTCATCTGTTCCATAATAATTGGTTATGCTTATAGACTTTTGGCTTGTTTG
CTGTTCTGAAAATGGCAGAAGCTGAAATCCAGTTGCTTGTGAAATAGATTGTTGTGGGGT
AATTCTTCCCCCCCCCAAATGAAATAATTTATAAAATACCTTATCTATAATGTAACTTCT
GACACCAATGAACGGCCCGGGAAAGTGCGATTGATGAGAGAGGACACGCTCCACGCCCCT
TCGATCCATGACAGATGGAACACCCGCGTGCTGCGGTGCTTAATTTTCGTTTGGTTTTGT
TTTTGGCAGATTGCATACGCCCGAATCGAGGGTGACATGATCGTCTGTGCAGCTTACGCC
CACGAGCTGCCGAAGTACGGCGTGAAGGTTGGCCTGACGAACTATGCTGCGGCCTACTGC
ACCGGCCTGCTGCTGGCCCGCAGGGTAGGGATCCTCTGTGCCCGGGCTCCCCCCCCCCTC
TGACCGGGGGCGGGAGGGTTTCGCTCAACTCGGGGCGAGGCGGCCGGGGGGCGGCTGTTT
CATTATGTCGGGTGACCGGCTTCGAGGAACGGAAGACTCACCTACCGCTTCCGTCCTCAG
CAGCGCACAGGCGAAGTGGCATTAATGCCCTTGGGAAAAGGCCGGGTGAGGTGTGAGTGG
GTGAGGCTCTGTGGATGAAGAGTTGGACTGGCAGGGCGTTTCAATCTTGGTTAAAGCTAT
TGTCATAGGGGCACCACTTCCACCCGGCCCCAGCCTCGTCGATTTCTGGGGGCGTCTAGT
GGGACCGGTAGTCGGTCGACCCTATTTACCGCGTGGTCTCCGTGCGCAGAGCACCGTATC
AAGTGCTGGGGAGAGTTCGGCAAAACAGTATACCCGACCCGTTCCCTGCCCACAATGAGG
TCTAGAGGAGGCGACGGGCATTAATAGAAACAAATATTACCTAAGTGCTGCGGGGACCTG
GTCCTTCTCTCCCAGATGCTTAAAGCTTCCCGGGTGGACGGGGGAACCCCGATTTAATAC
TGTGGAGAAGTGGGAAAGCAGAGCATGGTAAAGGAGCAGCTGAAACAGCGGGAATCCTCC
AGCACCGTGGAGCGCCTGATGGGCTCGGAACAGGTCTTACATTTTTGCGGCAGAAAGTAT
CGTTCGGCGGATGCTGAGTTAACAGAACTTCTGTTCCCAGCTAGTCAGACGTGAACGGGG
TTCTTGGGAGCCGGTAGCGAAGGCTGTTTTTAGGCACCCCGACGTTTTGCTTTCAGCTTC
ATTGCGAGCACATATGAAGATAGGATTCTTTTCGTCGACAGCTTCTTAACCGGTTTGGCA
TGGACAAGATCTACGAGGGCCAGGTGGAAGTGACTGGTGACGAATACAATGTCGAGAGCA
TCGACGGAAAGCCCGGCGCTTTCACGTGCTACCTAGATGCGGGCCTTGCCAGGACTACCA
CTGGAAACAAGGTCTTCGGAGCTCTTAAAGGAGCAGTGGATGGCGGCCTGTCTATTCCTC
ACAGGTAATTTTCCCGAGGCAGTCGGGGAAGGGCCAAGGGCTGGGGGAGAGGTTCCCTCG
TCGTTCTGTGGTCGCTGTTTGTCGTCGTCGTACTCTGCCTTCCCAAGCGCTTCGTACCGT
GCTCTGCACCCGGCGCTTAATAAATACGACCGAATCGAACGAATGAATGCGTGGCGATGG
ACGGTTCGAACCTCGCCCCCCCGCCCCCGGGGATTAGCTGCCGGATGATGATCTCCCACG
ACTGAGCATTCTGTAGTTGGTCCTTGGTTTGCACATGATGCAATTTCAGTGTTTCAAGAC
GGGACTGACGGCAGCGAGACCAAGTGTCGCGTGGAATGGCGGGATCCGGTCCCTTCGGCC
TACTAAACCGTGACAATTCTGTCGTAGTACCAAGCGCTTCCCCGGCTACGACTCGGAGAG
CAAAGAGTTCAACGCCGAAGTCCACCGTAAGCACATCATGGGCCAGAACGTTGCAGAGTA
CATGCGTTACCTCATGGAAGAAGACGAAGACGCCTATAAAAAGCAGTTCTCCCAGTACAT
AAAGAACAATGTAAACCCGGACATGGTAAGAGATTTACCTCGGGCGATAAACGAGCGGCC
CTAAAAAGGTCGTGTGCGGTGTGGAAGTCGGTTCCCGGGTTTCCGGCGGCTATGGATTTT
ACGGAGTGTGCCGTGGGTCCTTTCAGGTGGGATGTCCGAGCGAGCCCTCCCGACACTCGA
AAGCACTTATATAAAGAGAAAGTGGGGCCCCTGGGTGATACAAGATTTCCTAGGTGCAAC
AAGGATCTAAAGCCCGTCACGGCGTTTCTGACTTCCTGCGGGATCCTGTGTAATATAGAT
GGTGGGATTTAAGCGCTTACTCTGCCAAACGCCACTAAGCGCGGGGTAAATAGAAGATCT
TATGACACCCCTGCTCTCAGGTAACGCGGAGGCTACCTTGGATTGATGGAGTTTTTGATT
TGGTGGGTAGCCTCGGGCTGCTAATTTCTGGCAGGTCTCGCTTTCTGACCAGATCCCTCG
ATTCGCTGTGGGCAGGCAACGTGTCTGCCAACTGTGATTATACTCTCCCGATACTAGTAA
TCCCGGCTCTGCCACTTGTCGACTGTGGGCAAGTCACTTCACTTCTGTGCGTCAGTTACC
TCATCTGTAAAATGGGGATTAAGACTGTGAGCCCCACGTGGGACAACCTGATTCCCTTGT
GTCTATCCCAGCGCTTAGAACAGTGCTCTGCACATAGTAAGCGCATAACAAATACCAGCA
TCATTATTATTATTGTGGTATTTGTAAAACGCTTACTGTGTGCCAAGCACTGTTCCGAGC
CCTGCGGTAGGTAGATCATCAGGTCCCACCCACATGGGGCTCACAGGCTATGTAGGAAGA
AGCACAGGTACCGAATCCCCATTTTGTGGCTGAGGGAACAGGCACCGAGAGGTGACTCGC
CCAAGGTCGTGCAGCAGACAAGTGGTAGCCAGAATTAGAACCCAGGTCTTCTGACTCCCA
GGCCCAGCTTTCGCCACTAGGCCACACTGCTCCTCAAAGCACTTAGAACAGTGCTGTGCA
CGTAGTAAGGGCCCGATAAATGCCGATTCTATCGCTGAGACTTCTTTAACGCTCAGATGG
AATGTGCGTGTATTAGCCAAAAAATCACGCTTGCAAACTCGATCACTAGCTCTGCATGGT
GTTGCAGAAGCAAGGGGAACCAGGTTTGCTAAAGAAAGTGAGGAGATGGAAATCTTTCGG
CCTTAGAGGAAATGTCGGGGCTGTCTTTTCTCTCTCCCTACACGCGGTACTGTGGTTTTG
AAGCAATTTTGTTACCTTCAAACCGAGCTTCGGCGGCCTGAGATCGGGAGGGTCCTTGGG
TTCAGATTTGCTATTTAAGAACCCTTATGGGGCGAAGCTGCACGTGTGCTTAAGCACCGG
TTTGAGGATGGGCACGACTGGGCAGCTTGGAGCATTGCCAGTTCAAGGGTTAGTGTTTGG
GGCCTTTGCAGGAACACCGGTCTTGCCCGGTTCATCAACTTGTGAATTCTTTTCCTTCGA
AATTCACTCGGGGCTCAAGCTGGGTTGTGTATGTACTGTTCTTTTGTCTTTCTGGAAGCC
ACTTTAGAGATCCTTGCTTGCAAAATCAAGTTGACATGACCGGTGCCTGCCCCGATGGCA
GCCGCCATGAAAAGTCTTGACTGGCCCAGACCAGCTGGAACGAGATTACTGGGGGTGGGT
GGGTGGAGGGGGTGTCGTCCGAATTAGACTTCGTGGGTGAGTTCTGACTAGTAGCCCAGC
AAGGTAGATTTTTCTGCTTATCACGGAGTGGTGGCCAGTTGGAGAGATTGACCTCAAGTG
CCCTAGAATCTTAAGGCTCGGTCCGGGGAGGCGATCTCCAAGCTGCTGGCCGCGGCCCCA
CCCTCCAGGAGCCGGGAAAAGGAATTCCCCGTGTGCCCCCCGGCACACCCAAAGGACAGC
CCTCCATTAGGGAAGCAGCCTGGCCTAGTGGCAAGAGCATGGGCTGGGGAGTAAGAGGAT
GTGGGTTCTAATCCCACCTCCACCACTTGTCTGCCGTGTGACCTGGGGCAACTCAGTTAA
CTTCTTTGGGCCTCAAGTAACCTGATATGTAAAATGAGGATTAAGACTGAACCCCATGGG
GGACGGGGGACTGTGTCCGACCTGATTACCTTGTGTGTACCCCAGTGTTTACAGCAGGGT
TTGGTAAGCGCTTAACGGATACCGTAATTATTAGTATGAAGCCCCCGCTCCTGTCCTGGA
GTTCGGCATGGGAATTTAGTGCCGAGCTGCTAAATTAGCCTGGGCTTTGTGGAAGATTTG
AGCTAAATTGCACCCCCAAAACCCCCACGCCTTTCCTGGGTTGACAGAAGACTTTCAATT
TGTTGGAAATATTTGTTGTAGCAACATTCTGGTTTCCATCCTTAATCTGGCTTGGTTTTT
GACTAGACCCCCATTTTCCAGTATGTGGTTAGGTGAGGCTTACAGATTTTGGCAGAAGCA
CTGGATCTGAGTTAGGATTGGATCGAAGGGGTGAGTGGAATGCCAAGGCAGTGGTTTCTA
CTGGCAAGGACTTGGGGGGTGGGCGGGGGTTTCGGAGAAACGTGTTGTTCAACGTGTGAC
CCCATGGAAGCCTATCGTAGGTCCTTGGAGGTACCGCATGATTGCATTGCGTTAGTTAAA
AGTCAAATCGAAGACACTTCTGTGATTGATTACCCCTTATGGCTCCTTTTAGGGTTCTTG
GGGTGAAGATTCTGCGATCCCCTTGATTCTTTACTTGCTGGCAGCCAGACTCACACTTGA
GAAGTTGAGGGCCCATCCTTAGGACCCAGAGGTCACCGTATTATTAATAATAATAATGTT
GGTATTTGTAAAGCGCTTACTATGTGCAGAGCATTGTTCTAAGCACTGGGATAGATCCAG
GGTAATCAGGTTGTCCCACGTGAGGCTCACAGTTAATCCCCATTTTCCTGATGAGGTAAC
TGAGGCCCAGAGAAGTGAAGTGACTTGCCCACAGTCACACAGCTGACAAGTGGCAGAGCT
GGGAATCGAACCCATGACTTCTGACTCCCAAGCCCGAGCTCTTTCCACTGAGCCACGCTG
CTTCTCTTAATAAGGCCATGACAACAGGGTCTGTCGTACGTAGCTAATCGCCAGGTGGCT
ATATGCTAACTCCCCTCACATCCCAGGCGTTTTCAAGTTGAGTTGCTGGTAAGTGGGCTT
TGTGATTCCGAAATCCAGCACTTGGGCAAATTCCAGGGCACACTAGCGACCCGCTGACTC
GTTTTCAGAAGCCGGAGAAGGGGGGAGAATGCGTTTCCATATCTCGCAGGATAAAGGGCA
GCGTCGTCGCAGCTACCTTAATGGAAAACCAATACTGTTTGTCTCCTTCAATTTGTTTCA
GATGGAGGAGATGTATAAGAAGGCCCATGCAGGTATAAGGGAGAATCCAGTCTACGAAAA
GAAACCCAAGAAAGAAGTTAAAAAGAAGAGGTATGTAGAATTTTGGCCATTTCATTCAGT
GCACTGAATTGTTTAAAAAAAAGTTTTTTAGGGGGAGGAAACGGAGCATCTAGTACAGCC
GCTATCATGGAGGTAGTTAATGGGTGTTAAATGCCTATGAGGCTTTGATTGATTGTGGCA
GGAGGCCCACCTAGCTAGATGCCTCTCATGGATGGGGAGGTGGTTATTAAGTAGGAATCT
CACCTGCACAACACCGGCAAACTCGATCACTGGCTTTGCATGATGTTGCAAATGCAAAGG
GAACCAAGTTTGCTACAGCAAGTTTGGTGGAAATCTCAGCCCCGGAAACGCATTACAGAG
GCTGACTCTTCTGATCCAAAACACAAGCCGTTCGAGCATTCTGAAACTAGAAAAAGTCAA
TGAGCGCCCATGCGCTGAAACAGTCCTTGAACTCCCACACCCCTAAAGCCGCCGGCCAAC
TGGGAGACGGTCAGCGTAGATCACCTCTTGTGGTTACTAAGCACCGCCGCTTCACTTACC
CGTCGACTGCTTTTGGCTTTCCAGGTGGAACCGTCCTAAAATGTCCCTCGCTCAGAAGAA
AGATCGTGTGGCTCAGAAGAAAGCGAGCTTCCTCCGTGCTCAGGAGCGTGCAGCTGACAG
CTAAAGCGATGCACCCTGTCATTTTTACGGAGATTTTCAGAATGAGAATAAATTTATTGA
TGCAGAAACTCTCCGTGTGTTCATAAGCGCAAGCTGCCGGGGTTCCACTGGATGCCAAGG
TGGAGGGCCAAGGAAAGCCCTATCTCACTATTTCATAGTCCAGATAGGACCCGGGCAGCT
TTATGGCCCCCTGGATATCATCCTACAGTGAGAGGGGCTATCGGGTAGTGCAGAACACTT
GTAACCATCCAGGAAAATACAGCACAGTTGGGAGGCATGATAATTATGGCATTTAAGTGC
TTACTACCTGCCAGGCACTGTACTAAGCGCTCGGGTGGATACAAGCAAATCGGGTTGGAA
ACAGTCCCTGGGGCTCACAGTTTCAATCCCCATTTTACTGATGTGGAAAAGGGCATGGGG
AAGTGAAGTGACTTGTCCAAGGTCACAAGGCAGAGACAGGATTAGAACCCATGACCAAAT
CATTTGACTACCATTATTATTAATGGGAAAAGCAACCCATCAGATGTTTATTTTTCACCC
GGAGCCACAACAGTGGTAAAGCAAATCAGGAGAGTCTATAGAATAATAATGATGCTGTTA
ATAATAATGTTGGTATTAAGCGCTTACTATGTGCAGAGCACTGTTCTAAGCGCTGGGGTA
GACACAAGGGAATCAGGTTGTCCCACGTGGGGCTCACAGTCTTCATCCCCATTTTACAGA
TGAGGTAACAGGCACAGAGAAGTGAAGTGACGCCCACAGTCACAGCTGACAAGTGGCGGA
GCTGGGATTCGAACCCATGACCTCTGGCTCCAAAGGCCAGGCTCTTTCCACTGAGCCAGG
CCGCTTCTCTAAGCGCTTACCATGTGCCAAGCACTGTTCTAAGTGCTGGGGTAAATACAA
AGTCATCAGGTAGAGTTCAGTCTTAATCCCCATTTTACAGATGAGGTGACTGAGGCACAG
GGAAGTTAAGGGACCCACCCAAAGCCACACAGCTGACAAGAGGCAGGGCTGGGATTAGAA
CCCATGACCTCTGACTCCCAAAACCAAGCTCTTTCCACTAAGCCACGCTGCTTCTCTAGA
ATAGTAGTGGCTCTCTGATGCTTTCCAAGTTTACGGTCCTAATTTCCAGTGGCAAGCATT
ATCTCTTTCTCCCCAAACTGTTTTATCCACTAATGGGGCCTCAAAAAGACTCCATGATGG
AAAAATGAAATATTCCATAACGACACAGTTGAAGAAGAAAAGAACTTGGTTTCACTAACC
CCCCCCCCTAAATTTGAGTTTTGGGGTTAGGAAGATGGAGAGCCATTTTTTCTTGACTTT
TTTGAAGTTAGACAAGTTCAACGCGACTTCCCGGATCCTGTCTGTTACACGGTCTTTGGT
GAGCTAATGACGCCAACTCTGTTTCCCACCCACGGTGAAAATGGAGGAAGGTGTTCGGAG
TTGAATTAGTGAATGTTTTATGAGAGGAGAGAACATTTTTTGAAGCTACTTTAGTGACCA
ACAACTTGCCACTTGGCTGTAACCAATTCATCTATTGA
  Untranslated Region
  Coding Sequence
  snoRNA
1050..1133, 3748..3817, 3902..4017, 5049..5182, 6040..6243, 6627..6804, 10141..10229, 10764..11397
1131..1133, 3748..3817, 3902..4017, 5049..5182, 6040..6243, 6627..6804, 10141..10229, 10764..10863
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved