Ornithorhynchus_anatinus Locus ENSOANG00000030635
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus ENSOANG00000030635
Ornithorhynchus_anatinus
ENSOANG00000030635
Contig9155
SNORA7
5077..5219
15831
AGTACAGTGCTTTGCACACAGTAAGCACTCAATAAATATGACTGACTGACTGACACTGA
CTGAATGAATGAATAAAAGGAAAAATATGTAAGGGACCCACATGTCATGTAACAAAGAAC
AATTTTCCTTGCGTTAACTTGTGAGATGCAGTTTCTGTTGTGTACAGTACATCTTTTTAG
CCACAACTTGTTAAACATTTGGCTCCACCACCTGTCAGCTGTGTGACTTTGGGCAAGTCA
CTTAACTTTTCGGTGCCTGTTACCTCATCTGTAAAATGGGAATTATGACTGTGAGCCTCA
CGTGGGACAACCTGATGACCCTGTATCTATCCCAGTGCTTAGAACAGTGCTCGGCACATA
GTAGGCACTTAACAAATACCAACATTACTGTTATTAATATGTGCCAAGCACTGGGGAAGA
TGCAGGATAATCAGGTTGGACACAGTCTCTGTTCCACATGGGGCGCTCAGTCTAAGTAAG
AGGAAGTAGGATTTGATCCCCATTTTACAGCTGAGGACACTGAGGCACAGAAAAGCTAAC
TTGCCCATGGTCATAGAGCAGATGGGCAACTAAGATCACACGACAAATACCATTAACTTT
GAATATGAAAAATGGATGAACGTACATATTATGTGAATATATTTTTATAGACACACAAGG
TTATACACCATACAGCATTCGCTTGAACAGTTAAACAGCACACCGCTGTTGGAAGTGATA
TTGCGCAGAGGGAAAATTTGTTTTGCATTATGCCGTCGAGTCGTTGCCGACCCGTAGCCA
CACCATGGACACATCTCCCCCAGGAGGCCCCGCTCTCCATCTGCAATCATTCCGGTAGTG
GATCCAGAGAGTTTTCTTGGTAAAAATACAGAAGGGGTTTACCATTGCCACCTCCCGCGC
AGTAAACTTGAGTCTCTGCCCTTGACTCTCTACCATGCCGCTGCTGCCCAGCAAGGTTGA
GTTTTGACTCGTAGCAGATTGCCTTCTGCTCGCTAGCCACTGGCCAAGCTAGGAATGGAA
TGGACAGGCCTCTGCTTGACTCTCCCTCCCGAAGTCGAGACTGGTAGAGAACTGGAAACT
CTCCAGGTTGCGACCCTGAGAGGGGTAGAGGGAAAATCAGGCGCCAGGTTATTTTCACGG
GGGTAGTTTGGGTTTGGCCGAGTGAGTTCAATTTAAGAGAGTGTGTTTTGCTAATAATCG
GTGCCATGTACCGTGTCGGTTTGACGAATTCATGTTCTTCTCCCCCCATTTCCTTCACGC
AGTTATCAGAAGAGGGTAGCGCTTTACATTGCCGCATTTTACGGGCACGTCGAACTTACC
GAATGGCTCCTGAAGCAGGGGGCGAGGCCTGACGAGGCGGTCGGCGTTCACCCCTATCGA
GAATGGTGTCACGAAACCCATCACCCGGATGTCATTAAGTGCCCCGTCCACGCGGCTGCC
GAAAAAGGCCAACTGCTGATACTTAAAACGTTTGTCAACCGCAGCGTGCTCTGCCTGGAG
TGTCGAAATGCAGAGGGTCAGATTCCGCTCGCCCTAGCCATCAAAAACAAGCGGAAGGAC
TGCGTGTTGTACCTGGTGGCCAAGATGTGGTCCGTGGTTTCGTTTTCGAAAATTTCCGTC
CCCATGAGAATCTACATCCGACTGAAACGATGGCTTCTCGGGGCACAGAGTCGCATCCTG
ACTTGGAAGCGGCCTAGCGGATCGCGCGTCTTCAGGGCACGAGTTGGGGACGTCGTCTTG
GTGGACGGTTTCACCGAGCCTAGAATGACCTCCAGAGGGAAGCAGAAGGCCGTGAGCCCC
GTCGGCCTACAGGCTTCCGAACTGCCGAGAATCCTCGGGCAAACCCAAAGTCGCAGGGTG
GGGAAGCCCTGGGGGGCTTCCCGGCGGGACCCTCGCGAGGAAACCCTCCGACTGCCTCCA
GTTGAAAAGGGCCCCAAGATGCCCGAACTACAAAGAGGTCAGGCGAGGAGTAAGAAAAAA
AAGGCAGATTTCACCAACGGGATCGAGAATATGAGCTTCGAAAGCGTTCCTCTTCCCCCA
GTTTCAACAACTGGATATTCCCAGGCTCCTTTATACTCTGCCTCCCGCAACGCTGCTCTT
TTCCTGAGTTCCTCCCTCAAATCCTTCTCTGAACACAGTGGGAAGACGCCAAGAGAGAAT
GCCATCTACTGCTTAGCTGTTGCGAGGTAAGGCGAAGCAGCGTGGCTCAGTGGAAAGACC
CCGGGCTTTGGAGTCAGATGTCATGGGTTCGAATCCCGGCTCTGCCACTTGTCAGCTGTG
TGACTGTGGGCAAGTCACTTCACTTCTCTGGGCCTCAGTTCCCTCATCTGTAAAATGGGG
ATTAAGACTGTGAGCCCCATGTGGGACAACCTGATTCCCCTGTGTCTACCCCAGCGCTTA
GAACAGTGCTCTGCACATAGTAAGTGCTTAACAAATACCAACATTATTATTATTATTATT
TCATTCATTCGTTCAATCGTATTTATTGAGTGCTGTGTGCAGAGCATGGTACGAAATGCT
TGGGAGAGCACAACACAATAACAAACAGACACATCCCCTACCCACAACGAGCTTGTAGTC
GCTGTGAGTGTGTGGGAGAGGCGGGTCTCTAGAGCTGAGGCCGTGGGACCCCTTTGTATT
TCTTACTCTAGGACGTGCTGTCCGCGATCAACCCTCTGAGTCGATCAGTGGTATCTATAG
AGCGCAGAGCACCGTACTAGACACTTGGGAGAGTACAGCCTAACAGAGTCGGTAGACAGG
TTCCCTCCCCACAAGGAGCTTCCGGTCTTAGAGGAGGAGCTAGGCATTAATAGCAATAAA
TAAATCATGGATATGTAAATAAATGCTGAGGGGCTCTTGGGTGAGATGAATAAACTGTGC
AAATCCAAGTGCTAGGGAAAGGGAGTGGGGGAAGTGGAAATGATGAGACCTTCGTCTTGG
AAGAAATGGGAGGAATAACCTTGGTATTGGATGTCTACAAGATACGGGTATGGACTACCC
AATATATAGGCCCAGCTTCCCTGTTCTCCTGTTGCCTCGTCCCCTGTGACGTCAATACTT
TGATGTTACCTTGCAGATCTTCGCCACATCTCATAATGACATCATATGTGATAGAGCATG
AGTGCCCAGGATAACGAATATTACCCTATCACCCTATTTATTTTGTTAATGAGATGTACA
TCACCTTGATTCTATTTATTGCTATTGTTTTAATGAGATGTGCATCCCCTCGATTCTATT
TATCGCTATTGTTTTTGTCTGTCCGTCTCCCCCGATTAGACTGTGAGCCCGTCAATGGGC
AGGGACTGTCTCTATCTGTGGCTGAATTGTACATTCCAAGCGCTTAGCACAGTGCTCTGC
ATATAGTAAGTGCTCAACAAATACTATTGATTTAATGAATGAATGAAAAATAAGAGTGTT
TTATAATAGTAAGTGTTTAGTGCTTACTATTCATTCATTCATTCATTCAATAGTAATTAT
TGAGCGCTTANNNNNNNNNNGACAAAGAACAATGGCACTAAACAGCGTCAAGGGGAAGAA
CATCTCGTAAAAACAATGGCAACTAAATAGAATCGAGGCGATGTACAATTCATTAACAAA
ATAAATAGGGTAACGAAAATATATACAGTCGAGCGGACGAGTACAGTGCTGTGGGGATGG
GAAGGGAGAGGTGGAGGAGCAGAGGGAAAAGGGGAAAATGAGGCTTTAGCTGCGGAGAGG
TAAAGGGGGGATGGCAGAGGGAGTAGAGGGGGAAGAGGAGCTCAGTCTGGGAAGGCCTCT
TGGAGGAGGTGATTTTTAAGTAAGGTTTTGAAGAGGGAAAGAGAATCAGTTTGGCGGAGG
TGAGGAGGGAGGGCGTTCCGGGACCGCGGGAGGACGTGGCCCGGGGGTCGACGGCGGGAC
AGGCGAGACCGAGGGACGGCGAGGAGGTGGGCGGCGGAGGAGCGGAGCGTGCGGGGTGGG
CGGTAGAAAGAGAGAAGGGAGGAGAGGTAGGAAGGGGCAAGGTGACGGAGAGCCTCGAAG
CCTAGAGTGAGGAGTTTTTGTTTGGAGCGGAGGTTGATAGGCAACCACTGGAGGTGTTTA
AGAAGGGGAGTGACATGCCCAGATCGTTTCTGCAGGAAGATGAGCCGGGCAGCGGAGTGA
AGAATAGACCGGAGCGGGGCGAGAGAGGAGGAAGGGAGGTCAGAGAGAAGGCTGACACAG
TAGTCTAGCCGGGATATAACGAGAATTTTATAATTTATAATTATAATTATAATTTTATAT
ATTTTAAAATTATAATTTATAATTTTATAATTTGGCACATTTTACTATGTGCCAAGCACT
GTACTAAACACGGGTAGATACAAGGTAATCAGCTCCCACATCGCGCTCACAGTCTAAATA
GGAGGGAGGACAAGTACTGAATCCCCATTTTACAGTAGAGGGAACTGAGGCACAGAGAAG
TGAAGTGACAAGTGACAGCAGCCCAGTGACAGAGCTAGAATGAGAACCCATGTCCCGTAA
TAATAATAATAATAATTATGATACTTGTTAAGCACTTACTAAGTGCCAAGCACCGTTCTA
AGCACTGGGGTAGATACGGGGTAGTGAGTCCCTGTCCCACATAGGGCTCACACTCTTAAT
CCCCATTTTACAGAGGGGGCAACTGAGGCCCAAAGAAGTGAAGCATCTTGCGCAAGATCG
CACAGCAGACTTGTGACGGAGTCGGGATTAGAACCCATAATCTTCTGACTCCCAGGGCTG
TGTTCTATCCACTCAGCCATGTTGCTTCTTTGATGAAATGCCGTCATTCACTAGTCCGGC
CAAATCCCCAAGTCCTGAGAGATCCTCCAGAGGGATCTTGAGGAGAAGTAACATGGCTCA
GTGGCAAGAGCCCAGGCTTGGGAGTCAGAGATCATAGGTTCTAATCCCGGCTCCACCGCT
TATCAGTTGTGTGAATTTGGACAAGTCACTTCACTTTTCTGTGCCTCAGTGACCTCATCT
GTCAAATGGGGATGAAGACTGCAAGCCCCACGTGGGACAACGTGATTACCAGAGTTCGAA
TCCCAGCTNNNNNNNNNNTTTTGCCCCTTCTAAGCGCCTTCTACAGGAGTCGCAAGCCTG
GTAGAGTTTGCCAGTACTATAGCCAGTCTCGACTTCGGGAGGGAGAGTCAAGCAGAGACC
TGTCCATTCCATTCCTCGCTTGGCCAGTGGCTAGCGAGCAGATGGCAATATGCTACCGAG
TCAAGACTCAACTTTGCTGGGCAGCAGCGGCATGGTAGAGAGTCAAGGGCAGAGACTCAA
GTTTACTGCGCGGGAGGTGGCAATGGTAAACCCCTTCTGTATTTTAACCAATCAGACTGT
CTGGATCCAAAACCGGAATGATTGCAGATGGAGAGCGGGGCCTCGCAGGGGAGATGTGTC
CATGATGTCGTCCCTGGTCTCCTTCGACTAGACGACATAATGCAAAACAAATTTTCCCTC
CCCCCAGTATCAATTCCAACAGCGGCCAGGCTCGCTTAGTTCAAGCTCCCACAACCCCGC
TCTAACCTTCATATCTCCAAAAAAATATTCTCGGATCACCCACGTTCATCCATTGTTCAT
ATTGCCAGGTAATGGTATTTGTCGGGGCATCAGTGCCGCCCATCGTAAATCGGGGCATAG
GCCAGTGAGCTCCACTGGGGACAACTGTCGTCCCCTACAAAACCCCAGCGCTTAGAACTC
CTCTCGGCACGTAGGAAGGGCTTAACAAATACCAACATTATTTCTAATATTACCCCAGCG
CTTAGCCCACAGCTTGGCACTCTGGCAGCGCTCAACAAATACCGTTATTGTTAAGCGCTT
AGTACAGTGCTATGCACACAGTAAGTGCTCAATGAATACGATCGAATGAATCTTGATCCC
TGTTGTTGATGATGATGATGATGGTATTTGTTAAGCACTTACTATGTGCCAAGCACTGTT
CTAAACACTGGGGGAGATACAGGGTAATCAGGTTGTCCCACGTGGGGCTCACAGTCTTCA
TCCCCATTCTCCAGATGAGGTAACTGAGGCTCAGAGAAGTTAAGTGATTTGCCCAAAGTC
ACCCAGCTGACAAGTAGCAGAGCGGGAATTTGAACCCACGACCTCTGACTCCCAAACCCG
GGCTCTTTCCGCTAAGCCACGCTGCTTCTCGTTCATGCTCCAGAACCACTGTGTTCCCCT
CTCCGGTCCCTGTTGACCTAGGCACTGATTATGGCTTGGGGTGGGTCCTTGAAAATTTTT
ACCCACCGCCCACAGCTCCGACCACCCAGTGCCCCTCCACCGGGGTTGCGCCCTGAGGTG
GCTGCTTTCCTCACTTACCGTCTGAATCCATCAATCAATGGGACTTTTCGAGCACTTACT
GTATGCAGAGCACCGTACTAAGCACTTGGGAGAGTACAATACAACGGAGTCGATAGACAC
ATTTCTGCCCACGACGAGCTCACCGTCTAGAGGGGGTGAGAGACAGTAATAGGAATAAAT
AAATTAAGGACGTGCGTATAAGTGCTGTGGAGCGGAGGGAGGGGTGACTAAAAGGAGCAT
ATCCAAGTTCCAGGGCGATGCAGAGGGAGTGGGGAAGAGGAAATGAGGGCCTAGTCACGG
AAGGCCTCTTGGAGGAGATGGGCCTTCAATAAGGCTCTGAAGCGGAGGGAGGGCGAACTT
CTATCCGAGTTGAAGAGGGAGGGTGGTCTTGCCAGTATCCATTCAGTCATTCATTCATTC
AATAGCATTTAGTGAGCGCTTACTATGTGCAGAGCACTGTACTAAGCGCTTGGACTGTAC
AGTTGGGCAACAGAAAGAGACAGTCCCTGCCCAATGACGGGCTCACAGTCTAATCGGGGG
AGACAGATGACAGAGCAAAACAGAACAAAACAAAAACAAGACGACATTTTCATGGTAAAT
ATCTACTCTCTCTCCTCTTGTCAGATCCCCTTCCAAGGCGGATAATGCCTGCCGTGTGAC
CTTGGGCAAGTCACTTCACTTCTCTGGGCCCGTCACCTCGTCTGTAAAAAGGGGATACTG
TGGTACATGGACTGTGCCCAACCTTGTCTCTATCCCAGAGCTTAGTACAGTGCCTGGCAC
CTAGCAAGGACCCAACAAACACTGTTTTATAAAAAAAAAGGTCCCTGTTTTTTGTACTGG
CAGTATTTTAGCAACATAAAATCGGGCAGGATCCCACAGGAGCCTAGTTCCAGAGCCTAT
TTAAGCGTGGGCAGGGAATGTGTCTGTTATATTTTTGTGTTGTAGTCTTCCAAGCACTAA
TACACTGTCCCGCACAGGGGTTAGACTAATTGTCTTGTAAAGCAGGGGTAGTGAGTTCGA
ATGTCAGCATGACCTGCATCGACCTCGATACTTTATTTTCTAGGGAAGCAGCGTGGCTCA
GTGGAAAGAGCCCGGGCTTGGGAGTCAGAGGTCATGGGTTTGAATCCCGGCTCTGCCACT
TCTCAGCCGTGCGACTGTGGGCAAGTCACTTAACCTCTCTGTGCCTCAGTGACCTCATCT
GGAAAATGGGCATTAAGACTGCGAGCCTCACGTGGGACAACCTGATTACCCTGTTATCTA
CCCCCAGCGCTTAGAACAGTGCTCTGCACATAGTAAGTGCTTACCAAATACCAACATTAT
TATTATCAATACTTGGCCGAATGGACGGAACACAGACCAGGGAGTCAGTATCAGTAGCGG
GCAGCTGCGGGACCCAGGAGGCCGATGTCGAGCCGCTCCCGGGGAGAGGACAGACTCGTC
TACCATACACAGCTCTCCTTTCTTCTGTCTGTGACAAGGCCACTCCCCATTGCCTTCATT
AGCTACATTCTCAGCTAAGCTTTAATGATAAAAAAAGAATTCCTAGGTCCCCAGGGCAAA
TGATGCATTTCCAATTAAATAATAATGTTAATAATAATAATGTTGGTATTTGTTAAGCGC
TTACTATGTGCCGAGCACTGTTCTAAGCGCTGGGGTAGATACAGAGTAATCAGGTTGTCC
CGCGTGAGGCTCGCAGTTAATCCCCATTTTACAGATGAGGGAACTGAGCCACAGAGAAGT
TAAGTGACTTGCCCACAGCCACACAGCAGACAAGTGGCAGAGGTGGCATTTAAACCTATT
ACCTCTAACTCCCAAGCCCAGGCTCTTTCCACTGAGCCATGCTGCTTCTCTAATAATAAT
AATGATATTATAATAATAATGGTAATAATAATATTCATTAAGCATTTACTACATACTAGC
ACTATTCTACGCACTAGCATAGATACAAGGTAATCAGGTTGTCCCACGTGGGGCTCACAG
TCTTCATCCCCATTTTACAGATGAAGGAACTGAGGCACGGAGCCGTGAAGTGATGATGGT
TGGTCTCCATTTATCAGGTTCTTCCTTTTCCCTCTTTAAAGCCGGACAAAACATTTGCCC
TCTTCCAATCCTCAAGCACTTCTGTTGTCCTGTGAGTTTGAGGAAATCAAAGCCGGCGGC
TCCACAGTTATATCAAGAGAGGGCACATCAATCAATCGATCATATTTATCGAGTACTCTC
CCACCGTTACATCAAGAGAGGGCACGTCAATCAATCGATCATATTTATCGAGTACTGTGT
GTGGAGCTCTGTACTAAGCACATAGGAGAGTGTCACATAACAGACGATAGATATTCATTC
GTTCATTCAATTGATGAAATTGATGTATTCTGTGTGCAAATCACTGTACTAAGCGCTTGG
GAGAGTACAATATAACATGTTCCCTCTCTTCGACAAGATTACGGTCTAGAGGACAAGCAG
CAGATGGAGCTGTCCTGACTACATCAATCTCTCTGCCTAAACTAGTTTCCTCTCTGCCCT
GCCCTGACATATGGAAGCTTGAGAAACAGAGGGAGAGCATGGGCCTGGGCATCCGAAGGA
CTCGGGTTCTAATCCTCGCTCTGTCACTTATCTGTTGGGTGACCTTGTGCAAAGTCACTT
AACTTCTCTGTACCTCAGTTACTTCATCTGTAAAATGGGGAATAAGACTGTGGGACATGG
ACCGTGTCCAGTTATCTTGTATCTACCACAGCACCTAATAGAGTGCCTGGCACATAGTAT
TCATTCATTCATTCGGTAGTGCTTACTGTGTGCAGAGCACTGTACTCTGGGGAAAGGACA
ATACAACAATCAGTGGTGACATTCCCTGCCCGCAAAGAGCTCAGAGTGGGGGAGACAGCA
ATACAAATAAATAAAATGACAGATATGGACTTCAGTGCTTTGGGGCTGGGAGTGGGGAAG
AGCAAAGGGAGAAATAAAATGACAGATATGTACGTAAGTACTTCGGGGCTGGGAGGGGGA
AATAGCAAAGGGAGCAAGTCAGGGAAACGCAGAAGGGAGTGGGAGATGAGGAAAAGTGGG
GCTTAGTCAGGGAAGGCCTCTTGGAGGAGATGGGCCTTCAATAAGGCTTTGAAGTGGGGG
AGAGGAATCGTCTGTCGGATTAGAGGAGGACGGGTGTTTCAGGCCAGGGGCAGGATGTGG
GCCAGGAGTCGGCAGGGAGACAGGCGAGTTGGAAGCACAGTGAGAAGGTTAGCACCAGAG
GAGCGGAGTGTGTGGGCTGGGATGTAAAAGGGGAGAGGCGAGATGAGGTAGAGGGGCAAG
CCAATGGAGAGGAGTTTTTGTCTGATAGAGAGGTGGATGGGCAACCACTGGAGTTTTTAG
AGGAGCAGTGTGATGTGTCCAGAAATTTTCTGTAGAAAAGTGACTTGACAAATATTCATT
CATTCATTCATTCATTCAATAGTATTTATTGAGCGCTTACTATGTGCAGAGCACTGTACT
AAGCGCTTGGGATGAACAAGTCGGCAACAGATAGAGACAGTCCCTGCCGTTTGACGGGCT
TACGGTCTAATCGGGGGAGACGGACAGACGAGAACGATGGCACTAAATAGAGTCGAGGGG
AAGAACATCTCGTAAAAACCGATGGCAACTAAATAGAATCGAGGCGATGTACAATTCATT
AACAAAATAAATAGGGTAATGAAAATATATACAGTCGAGCGGACGAGTACAGTGCTGTGG
GGATGGGAAGGGAGAGGTGGAGGAGCAGAGGGAAAAGGGGAAAAAGAGGGTTTAGCTGCG
GAGAGGCAAATACCAATAATAAAAAAAAAAAATATTCTGGTCCACTGATCCCATTTGATC
TCTGTGACACAAAAGGAAAAAGAAGGAAATCCCTTCAGTTTTTCACAATCAACCGACATC
GGCTTTCCCTTCAGTGTGTTTTCACAAGAGAGGAAAGGACCAAGAACCTCAAAGACATGA
GACAGCTTGGAAGATGAAAAGGGAAGGAAGAGCTTGATTGAATGACAAACTCTGTCACAG
TACATTTTGAAGTTAGGAAATCTAGACTGAATGGAGCAGAGCTATAGATGGAGCAGAACA
AAATTAATAATGTTGGTATTTGTTAAGCACTTACTACGTGCAGAGCACTGTTCTAAGCGC
TGGGGTAGACACAGGGGAATCAGGATGTCCCACGTGGGGCTCACAGTCTTAATCCCCATT
TTACAGATGAGGTAACTGAGGCACCGAGAAGTGAAGTGACTTGCCCACAGTCACACAGCT
GACAAGTGGCAGAGCTGGGATTCGAACTCATGACCTCTGACTCCAAAGCCCGGGCTCTTT
CCACTGAGCCACGCTGCTCCTCGACTGTGAGCCCGTTGTTGGGCAGGCATTGTCTCTATC
CGTTGCCGAATTGTACATTCCGAGCGCTTAGTACAGTGCTCTGCACATAGTAAGCCCTGA
ATAAATGCGATTGAATGAAGCGTTTAAAATTCAAAAGGGGATTTCCAAGTATATTTCTCT
TTTTTATGGCATTTTTTAAGCACTTACTACACGTCAAGCATGGTTCTAAGCGTTAGATAT
TTATAAATAAATCTGGCCGGAAACAGTTCCTGTACCCTACGTGGCTCACAGTCTAAGTAG
GAAGGAGAGCGGGTATTGAATCCCCGTTGTTTGTAACTGAGAGAACTGAAACAAAGAGAA
GTTCAGTGACTTACCTGAGGTCACAGAGTAGGCAAGCGGCAGAGCTGGGATTAGAACCCA
GGTCCTCTAGCTTCCTGACCCATGCTTTATCCACTAGGCCCTGCTGCATCACCCTTATTT
CACACAGAGAAGAAAAGAATTAGGTTTAAAATTGTTTTAAGCCTCTCAATCTTCTCAGGC
ATTTTATAATTACTGAAACAACAATAAGTAAATGATATCTTAGAATCGACCTCATCTGTT
GAAATTGGTGGTTCTGACCTCCGAAGGGTAAAGTTGAGGTGCCTTTATACCTCGCCTAGC
TGAAAAATGGTTGCCATTGAGAGGCAATAGTGATTTGAGTTGTTTTTTATGGAAGGACCC
ACGATAAGGCCCTTTAAATTAATGAATTAATCAATCAATTAATGATATTTAGCGAGCACT
TACTATATGCCATGCAATGTACTAAGTGCTTTGGAAAATACAACAGAGTATACTGCACGT
AGCCCGGGCAGGTAGAAATTAGGCCTCTTAGAGAACTTCTAAATGCCCGATGCATAAAAG
AAGCCTTAAAAAAACAAACCCAAGCAATGAAACCCCTTAGCGAGGGGAGGGGGGGGAAGG
GATAGAAGCAGATTTCAATCAATCGATCAATGGTATTTCTTGAGCGTTTACTGTGTGCCC
AGCACTGTGCTTGGGAGAGTACAATATAATAATATAGCAGAGTTGGTAGACAAGACCCCT
GCCCATAATGAGTTTATAGAGGGGAAGGCGGACATTAATATAAATAAATAAATTACAGCT
AGGTACGAGAGCCTGGCTTTGGGAGTCAGAGCACATGGGTTCTAATCCCGGCTCTGCCAC
TTGTCCACTGTGTGCCCTTGGGCAAGTCACTTAACTTCTCTGTGCCTCAGTTACCTCATC
TGCAAAATGGGGATTAAAAGTGTGAGCCCCATGAGGGACAACCTCATTACCTTGAATCTA
CCCCAGCGCTTAGAACAGTGCTTGGCACATAGTAAGCGCTTAACAAATACTATAATTATT
ATTATTAAGTGCTGTGGGGCTGAGGGAGGAGTGAATAAAGGGAGCAAATTCATGTGTGAG
GGTGACGTAGAATGGAATGGGGGGAGAGGGAATGGGGGCTTAGTTTCTGCTGCAGATGCC
CTCGGCTAATAATTACAGACCGTCCATCGAGGTGCGTGATTTATGAGGTTTCGACGATCA
TTTACAGTCCATTCTGTTTTAACACTCGTTCTCATTACATGATATGGACACAAAACAGAA
GAATTAGGGTGTTTTTTTTCCCCACTACACAGATCTGTTCTGCGTATAATCTAATCCATA
GGTTGGCGGTGCCAGTTACCTTCAGTGGAACAATGGTTGTCTGCCTGTGCCTGATAACGG
TCAAGGTGCGATGTGATACACAACAGTGGTGTACAGCGTGTCTGATATTGGCGAGGGAGT
GATGGTGAATCAGCCGGAAGCCTCTGCCTCAGCTTTATGGAGTGCTACCCTACAGTACCT
AGTGTTTTGAGCAACTTTAGAGTGTAGAAATACAGTAAAAGAACAATGGGGGACAAGGGT
AGAAAACATTCTGCTACTGGTGGATATAACAGTGTAAGAATTTGTATCCGAAACTGCCAA
TCTTCGAACTCGCTACATCCTGTTGAATCGACCATCACTATAAAGTTATTTTCCCCCAAC
CCCAGGTTCTTCAAGAAACAGCTCCTACATTAGAGAAGCAGCGTGGCTCAGTGGAAAGAG
CCCGGGCTTGGGAGTCAGAGGTCATGGGTTCTAATCCCGGCTCTGCCACTTGGCAGCTGT
GTGACTGTGGGCAAGTCACTTCACTTCTCTGGGCCTCTGTTACCTCATCTGTAAAATGGG
GATTAAGACTGTAAGCCTCCTGTGGGACCAACTGATTACCCTGTATCTACCCCAGCGCTT
AGAACAGTGCTCTGCATAGTAAGCGCTTAACAAATACCAACATTATTATTATAGAACTAG
GAGTGTATTCTACAACTTTGTGGGCGTTCAAGTGACTTTTGGGATTGAGCTCAAATCCCT
AACGTAGCTTTGGAAACTCTGAGCCACGACGCCCCATGGTAAATGCTGGGTGAATGCCAG
CGAGGCAATCGATCCTTAAAAAGAGAAAAAACTCAGTTTCTTCGGATGGTTTTTTATTTA
ATGCTCTAAATGCTAACCTTCTCACTGTGCCTCGATCTCATCTACCTTGCCGCCGACCCC
TTGCCCACGTCCTGCCTCTGGCCTGGAGCGCCCTCCCTTCTTACATGCGACAGACAGTTA
CTCTCTCCTGCTTCAAAGTATTATTGAAGGCACACCTCTTCCCGGAGGCCTTCCCTAAGC
CGCCCTTTCCTCTTCTCCCACTCCCTTCTGAGTCACCTTGACTAGCTGCCTTTATTCTTC
CCCACTCTCAGCCCCACAGCACTTGAGAACATATGCCATTTATTTTTTATATTTATGTCT
TCCTCCCCTCCTCTGGACTGTAAGCTCACTGTGGGCCGGGACTACGATTGTCGTTGAATC
GTCCTCTCCCAAGCACTTATTACAATGTCGGCACACAGTGAGCACTCAATAGCTCAACAG
ATACGACTGACTGAATGAATGAATAAATGAATATTTGACCTGCAACCTCAGGTTGTAAAG
TCATTTAACCTGAAGAGCTGCTAAAACCAGCAACTGAAGGCAAAATACAGTGCATTTAGG
TGTTTCCCTTAATTCCAACCTCAGCTGAGAGTGAATGTTTTCTGTCAGGCTCTCTCAGCC
CACAGGGCTTGCCTCCTTCCTCCCTCTTCCTCCCTGTCTGTCTCCTTGTCACCCCCGACT
CTTTCCGACTCGCTCTACCTTCTTGACTCTACCTTCCTGACTCTCTCTGCCTCCCTGATT
CCTTCTGCCTCCCTCTGCCTTTCTTGGAGAAGCAGCGTGACTCAGTGGAAAAAGCACGGA
CTTGGGAGTCAGAGGTCGTGGGTTCTAATCCCGGCTCTGCCGCTTGTCAGCTGTGTGACT
TTGGGCAAGTCACTTCACTTCTCTGTGCCTCAGTTCCCTCATCTGTAAAATGGGGATTAA
GACTGTGAGCCCCACGTGGGACAACCTGACTCCCCTGTGTCTACCCCAGCGCTTAGAACA
GTGCTCTGCACATAGTAAGCGCTTAACAAATACCAACATTATTAATCCCGACTCTGCCAC
TTATCAGCTGTGTGACTGTGGGCAAGTCACTTCACTTCTCTGTGCCTCAGTTACCTCATC
TGGAAAAATGGGGATTAAAACTGTGAGCCCTACATGGGACAACCTGATTACCTTGTATCT
ACCCAGCGCTTAGAACACTGCTTGGCACATGGTAAGCGCTTAACAAATACCAAATTATTA
TTACTATTACTTCTCTGGGCCTCCCTCCCTCCCTCTGCCTCTCGGTATCTCTCTGTATCC
CTGCCTTCATCTTCCTCCCATTTCCTCCCTCCCTAAATCCAAACTTAGAAGGGCCTGAAG
ATTATCTCCTGAGTCAGATTTCCCCACCTGCAATTTCTTCGGATAATAAGACTGGAGTCC
CATCGGGTAATATCATCTCTTATGTTTGGGAGAAAAGACCTGAGGGTGTTGTTTTATTTT
CAGTGCGTTTAAGAAGAAAGGATGGCTGCAGCAGTTGGCCATAGCAAGAATTCTAGCCAA
GAGGAGCGTTTCCAACCCCACTGCTGGAAGAAGCCTGACTATAAATCAAAATCCGCTGGG
ACCTGAGCTTTGAGAAGGCGAGATAACCCCCGTTGGACTTGGCTCCATGTCCTAGCACCT
GCAATTCAGATTTTTTTTTTTAAACTGAAACATTTTCTTTCAGAAAACCCTTGCTCTAAG
TTAATGTCTCAGCAGAATTATTTGAACTCGCCCAAAATTAGTTTCCAGAGGGTGCAGAAT
AGTGAGTGAAAGTGCAGATGAGCTCGTTCAGGCTTCAGACATCACCAACTAAAGTGCATA
TTCCTAGCAGGCAAACTTTGTAAAGTAGGAGGAGACGCTTTCTGTGGATTTCCAATCCTG
TAATCAGCCATCATCATAGTCATTACTGAATGCTTACTATGGGTAGAACACTGTACCAAG
CGCTCGGGAGAGTACGACGGAGTCGGCAGACACGTTCCCTGCCCACAACGAGTTTACAGT
CTAGGGACGAGACGGCAGTCGTTTTTGCTCGTTGATGGTACTGACCCACCGATACTTGAA
ATTCAGCATTTCATGTGTTATCGTGAAATGTTCTCTGAGCGCAAATCTATGTTTTGAAAA
TAATTAGACCCGTGATACAATTTTGAAAACGTCTTCTTCCCTCTAAGGGTGTTTATATAA
ATGCAGAATTCGTGTGTTCAAAGTAAAAGCTCCCCAAGGGCGCCATTAAGCCTAGAAAAT
TCAATATTTCCATAGGATTAGGATATTTGAACAACAGAAAAACCCATCAACGCTAATGTA
TCGTTTGGACGATATGATATTTTTAATAAAAATATTTCTTTAAAGCTATTACACCTTCCT
GCCCATGCGTGCTTTGTGGGGGGACATAAAATAGATTGTATTTCAATGCAACGTGATTCG
GCCACGTGCCCCCGCTGAGCGAGATGAGACTCTAATAGATGTATTTTTCCCCCCAGAGTA
AACACTCCGAGGGGGCCTCTTTCGGCTGGGGGAAGCGCCCATCTGTGAATCGGAAAAATT
CCTGCCCTGCAACTCGAGCTCTAGCTGGGCTCTTTTACAGACAAATCAGTACCTTGTCTT
TTAGACTGTGAGCCCATCGTTGGGCAGGGATCGTCTCTATCTGTTGCCGAATTGTACATT
CCAAGCGCTCAGTGATCTGCCCACAGTAAGCGCTCAATAAATATCATTGAAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..2185, 14583..14831
1584..2185, 14583..14712
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved