Ornithorhynchus_anatinus Locus Poly:SNORD30
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Poly:SNORD30
Ornithorhynchus_anatinus
Poly:SNORD30
Contig86933
SNORD30, SNORD31, SNORD22
152..220, 1031..1098, 1289..1415
1866
TTTGCCACTCCTTGCTACTTTCTAAGTTCTCATACCTTTTTTTCCGCTTTATATAGGTC
CTTAGAGAACAACTGCCAGTGGTGAGTTAAGGAAATTGACTGGGGTTTTTTGGTGGTGGT
ACCCAAGTGTGAGGGCAAAATTTGTGAGGGGAGGATGTGATGAATTTCTTGGAATCTCGT
TCGGCTGAACTCTGCTGTTGAGACTTGGAAATCTGATTGTCAGCAGTAGCTGACGTTGGG
AGAAGGATGGAAGCCTTGCTGAAGGAAATGTTCTGAATCTCCTTTCTGCTTGTTACAGCT
TACCCGTTTTGATAGGGTCAAGACAAGACTGAATAAAGGTAAACTCTTTGCCTAACTCCT
GAAGTGTGCCTGACTCAAACAGCCCTCCTAATTGTCTGAAAATGCAAACTGCCCAAGTGG
ATTTTGAATTAGGCACCCTGAGCAGTCTTTAACTGGCCAAGGAACATTGCTCATTGATGG
ATGTGAATCTGCTGGGTGACCTTGGGCATCCTTCACTTGTCTGACTGCCTTTGTTACCTC
ATCAGTAAAATAGGGATTGAGACTGTGAGCCCCATGTGGGGCAGGAACTGTGTCTAACCC
AATTTGCTTGTCTCTGTCCCGGCGCTTAGTATGGTGCTTGACAAGTAGTAAGCACTTTGC
AGATACCTCTTATCCATCTCAACAGTTAATGAAATGCAGAACAATCCCATCCCCTGGTAA
ATACCCAACCTCATAGGTGGGAAGAGGGTGGGTATGCTCTCCAAGGATGATTTAGTACCA
CCTTAGTCTGGTTGCTGGTAATCCCCATCTGAGCTAGGAGCAGGGCATTAAATTAGAGGG
ATTGTCAGACACCCCCCCCCCCCCAATCTAATGTTTGCCTCCTCTGAACATGGCAACATC
AAGTGAATTGCTAAATTCATGATCCCTGTTTTTCAGCTTCTTATGCCTGGAAACATTCTC
AGTGTTTGGCAAGAGAAATGGCAGTTTGGGTAAGTATTAATAAAGGGAAGATGAGGGAAT
TGCAGGATAGCAATATTCTGTGATGAATCTATACCGCCCCAGTCTGATCATTGTGACTGA
AAGGTAATTCTGAGCTGTCAATCCTGGGTCTCCACCCCCCATTTTCATGGTCAAGTAAAT
CTACTCTTGATTTAGCATCACTTTTTTTTTCCTTTTCAGGAGATTGTTGACTGTATCAAC
TCTGACTGCCTGGAACCCTTCAAAAGAGCTGGAACAGGTAAGGGGGAGACTTCAGGGAGA
AGGAAGTTGAAATGTTATTGTCCCCTGGGTCCTAATGAAGAAAACCAGCACCTGTCTTAC
TCCTTGTCCTGGCCCCAGAGCCTGCAAAGGCGAACCCACTGGGGTCGGCTGGGGGAGAAG
ATGATAATCTGTTCCAGCGGGAACAGTCTGAGGGACCCATGTTTAAAAACAAATGAATTT
TTTGTGGTTGAGCTTTAATGCCTCAGCTGCATTCCCTTCTTGCAACAAACGTGGCTCAGT
CATTACGTCTTATCATGACTTTGGAGAGCCTTTTCACTGCTATGTAACCCCTCAAGTGAT
TAGCTAAAGCATATCCAACTGGCCATACCTATATCATCTCCTTTTACCGTGTACAATTTT
CTGCTTAAGTCCACTATACATATATGCTGTGCACATCAGTTGAGAACATGCACCTTGCCT
TTTAGAGGATTTTAAGTAACACACCCTTTTACATAACTTTCTTTTTCTGCAGATGCTGTT
GAGCATTTAAGCTCAGAACAACAAAACATGGTGAAAACAACCCTTCTCATTCTTTAAATA
AACTTTAAAAGACTACAGATTTGTGTCTTGTGATTTTTTGGTGGTGGGTTAAAAACTGTG
GGAAGGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved