Ornithorhynchus_anatinus Locus ENSOANG00000034634
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus ENSOANG00000034634
Ornithorhynchus_anatinus
ENSOANG00000034634
Contig8526
ACA64
1888..2017
4368
gcttactatgtgcagagcactgttctaagcactggggtagatacagggtaatcagggtg
tcccacgtgaggctcgcagtccaatccgaccccagtgcttagaacagcgcccgccacata
gtaagctaaaatactattgttatcattattagtcccagagaacagtcttgccaacctggc
tgggctccagcgggcaaacatggcaccttttggggccatgccactccctctggtactaat
atgagcattcccgcaggaggttcctacttaggagggctcagcagagcactgcttcattgt
tcagacaaccgctggtggtgttttttatggtatttattaatcgtattcattaagcgcttc
ctccgtttgaggtcctgttttaagcactgggatgggtacaagaaaattaggttggacgca
gtccctgtcagtcctatttattgaacgcttactgtgtgcacagcactgtactgagaactt
gggagaataaaagaagaataaagacacattccctgcccacaacaagctgacggtctaggg
aggcagacatcaacagaaagaagtaaatgacatatgtatctaagtgctgtggggctcgtg
gttttaagccccattttacagatgaggtagctgaggcccagagaagtgaatgacttgccc
aaggtcacatagctgacaaggcagagatggaattagaacccaggtccttctgccgcacag
acccgtgctctggggccagcgttcttattcccgttttacagctgaggtaacaaggcccag
agccctgcttcccctcgttcccaaggtgtaattgagtgtagaagaggcannnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnntgtggtggattcggggGGGGGCCTGGGCTGGCGCC
ACTAGGCTCCCATAGATTGACCGATAGGGGCGGGCCGAGCAGCAATGGCGGCGCCCCGAC
CTTCTTCATCCGGGGACTTGCGGCCTGAGGGAAGGCACCGCCCCTCACCCTGAATACACC
AGCTCCCGGCTTTTCGGATTCTGATTGGTGAATCCCCCTCCCGCCCCGCCCTTTTCCCCC
CGTCCTGTGAGGCGCATGGGCAGACTCGGGCTTCTGATAGGTCGGAAGGGGAGCCGTGCG
GCCCCGGAACCTGCATAGGAAAGAAAGACGCCTATAAATAGGTGGGGCGGCGCGTGTGCT
AGTCCTTAATTGGTGCCGAGCGAGgtgagtggggctgcttgcaatggggggggggggggg
ggggtgcgtgggggggggtttagttaatagtaattaattattacgatattagttataagc
gcttactgtatgccaagcactgttcctagtactggggtagagtggaaagagcccgtgctt
gggagtcaggggtcgtgggttctaatcccagctccccccttgctgctgggcaagccgatt
cacttttctgggcctcagtgacctcatctggaaaatggggatgaaggccgggagccccat
gggggacctcctcattaccttctatctcccccagctcttagaacagtgcttggcacatag
caagcgcttaacaaataccattattgtattgcagggtcatcaggttgtcccacggggctc
acagtcttcatccctattttccagatgaggtcactgaggcctagagaagtgaagcggcct
gcccaggggcacacagcagacaggtggcctgggcggaattagaacccaggtcctctgagt
cccagggcgggcgaggcccccgcccgacgccgtctgaaagtcgcccgcggcctgacccgt
ggccgcgagtgagaccccggcgcccacagacacaggggcctaaagcttgtcgcccaccgc
cctgtcgtgtcggcgacaaaacccgggccccgacaggccccccttgatgatatttgttaa
gcgcttactatgtgcagagcactgttctgagcgctggggtagatagcggatagtcagatt
gtcccacgtggggctcgcattttttaatccccatttttgcagatgaggtctctgaggcac
agagaagtaaagtgacttgcccacagtcacacaagtggcagagctgggattcgaacccac
gacctctgactcccaagcccaggcgcttttcactaagccatgccgcttctctaatggggg
ccgtgcctccccttcttactggccatcttttttcatccctagGTGCTGACAGATGGACGG
ACGGACCAACGGCCCGGCGGGACCCCCGACTCTTTTAGATGTCCCCATGCTAGACTGAGC
CCCTTGAGGCCGGGGTTCATTCATTCAGTCGCATCGAGTGCCTACTGTGTGCTGAGCACT
GTAACGATAATAATAATCGTAGTGATGGTATTTGTTAAGCTTTTACTCTGTGCCGAACAC
TTTCCTAAGTACAAGGTGATCAGTTTGTTCCCCTTGGACAGGCTTCATCCCCCTCTTAGA
GATGAGGTCACCGAGGCACAGAAAAGTTGTGACTTGCCCAAAGTCACCCAAGCTGACAAG
TGGCAGAGCTGGGATTAGAACCCACCACTTCTGATTCCCAAGCCCGGGCTCTAACGGCTA
AGCCACGCTGCTTCTCTGCTCCTAATCAGTATTTATTGAGCGCTTACTAAAGTTTGGGAG
ACTACAATTAAATAGAATTGGCTGACCCGTTCCCTGCCTGGAAAGACCTTACAGCCTAGA
GAGAGGGGAGGCTTCCTAATATACTGCGCTCCTAATCAATATGTATCAACTGGTTACTGT
GTGCAGAGCACCGTACTAAGCGCTTGGGAGAGTACAACAGAATTGGCTGACCCATTCTCT
ACCCGTAATGAACTTGCAGTCTCCCTCTGTTCAGGGTTCTGCAGGTGCTCAATAAGTACT
AAATTGTAAGCTCCTTGGGTGGGGAAGGGATCTTTACACAATAAATTGTAACGTCCTTGA
AGGCGGCAGTTAGGGTCTGACTAGGCAGCCGTCTAGTACAGTGCTCTTCAAAGTGCTCGG
TGATGTCTGGTTTGAATAAATAAAGCTTCTGAACCTGGCCTGCCATGTGTTGTGTGTGCT
GGGGTGCACCGTGGGGGTGGGAGGGGGTCCCCGTCCCCCTCCCGGGGGGCGTGAGGGGGG
CTGACAATGGAGCTGTGATGCAGGTGCTTGTTCCCGGGAGCGGGCCGGGCTGGGCCTCAG
TAGGGCTGTTAACGCCAAAGGACTGAACATGGTGAGTGCCTGCTTCTCCCCAAGTAAGTG
GGGTCAATAattttagtacttctaaagccctcttctaaatgccaagctaatcgggttgga
ccccaggcatgcccccatgtgggttcaccatctttaaatcctcattttgcagatgagaaa
acaggtgtggtggaattgactttgtctaaggtccccgttgccagattctgttacagaggg
gttattaagaaccctagcctctttcagacctaaaacggaccagtgtatgttttgctcnnn
nnnnnnnacatggggcatggactgagtccaacccgattagcttgacacttagaagagggg
ctttagaagtactaaaattactgacgccacctacatgggagaagcaggcactcaccatgt
tcagtcctttggcgttaacagtcctactgaggcccagcccggcccgctcccgggaacaag
cacctgcatcacagctccattgtccgtccccctcccggggggcgtgaggggggctgacaa
tggagctgtgatgcaggtgcttgttcccgggagcgggccgggctgggcctcagtagggct
gttaacgccaaaggactgaacatggtgagtgcctgcttctccccaagtaggtggggtcaa
taattttagtacttctaaagccctcttctaagtgccaagctaatcgggttggacccaggc
atgccccatgtgggttcaccatcttaaatcctcattttgcagatgagaaaacaggtgtgg
tgaaatgacttgcctaaggtcccgttgcagatctgtggcagaggggttattagaaccctg
gtctttctgacttaaaaggcctgtgttgttttgctctactgattatatagggggaatccc
ctcccctgtatctctttttatggctgcttttgagtgcttactatgtgcctggcactgggg
tagatataggctaatagtccatgtcccacatgtgccttagtcttaaaccccattttacag
atgagggaactgaggcacagaaaaaccaaatggctcgccaaaggagcaa
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1343, 2322..3368
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved