Ornithorhynchus_anatinus Locus Mono:SNORA52
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SNORA52
Ornithorhynchus_anatinus
Mono:SNORA52
Contig83296
SNORA52
1001..1096
1164
GAATTCCATGATTGCAGAGCCTTTCATATTTAAGTACAGCGCGGGTATTGGTGTAATTT
CCCCATAAAGAGAACATCCTCGCTCCGAGCATCCCATTACCCTCAGTTCTTTCATAGGGA
AAATGTAGCATGATCTCAGTGATGTACAGGATTGTCGTCCAATTCAATATGCACTCGTCC
TCCCCGGCGTTGAGTACAGTGCGCGGCGCAGAGTCAGTGCCTGACGGGTACGTTGTCACG
ATGTGGCAAGCGCTGTTCCGAGTGGGGCTCGGAGTCTGAGTAGAGGTCAGTCCCCATCTC
ACTGGGAGGGTAACTGAGGCACGGCCAATTGCCCAAGGTCACCGTCGGGGCCGGGATGAG
AACCCAGGTCCTGTGACTCCCCGGTCTGGTCTCTTTCCAGTAGGAGGCGCTGCCGCTCTC
CAGTGGGAAGCAGCGTGGCTCAGTGGAAAAGAGCCTGGGCTTCGGAGTCCGAGGTCATGA
GTTCGACTCCCGGCTCTGCCACTTGTCAGCTGTGGGACTGTGGGCGAGTCGCTTCACTTC
TCTGGGCCTCGGTTACCTCGTCTGTAAAACGGAGATTAACTGTGAGCCCCACGTGGGACG
ACCTGATTCCCCTATGTCTACCCCAGCGCTTAGAACAGTGCTCTGCACATAGTAAGCGCT
TAACAGATACCAACCTTATTATTATTATTAAAAGCGCCCCCGCCCACAGTGAGCTAAACG
TCCTGCCCCGAGCCCGCCACCCGCCTGCCACCGGGCCTGGGCCGCGGGGCGGGCTGAGCC
ACCCGGTGCCCTCTCGCCCTCCCGGCTCGGGTTGGCGCCGTGTCCCGTCTTGGTTTTCCT
CGCCTTCCGGAAAGAGCCGGGAGTCGGCCGGGGCCGGGGGGGGGAGGGGGACACCCGGCC
AACCTCGCTGTCGGTCGCCCCGCAGGTGATCGGCGAGCTCAACGGGAAGAACATCGAAGA
CGTCATCGCTCAGGGTGAGTGGGGCTCAGGCCCGCCCCTCGCCGTCCATCATAATGACCG
CTGGCCGACCGCCGTGCCTGCCGGGTTTCGCTTTGTGGACACAAGCAACCCCCACCCGGC
CCAGGGACGGGTGATTCCGCGGTGAGACGTCACCCCGGGGCAGGGGGGAGGACATGGGCT
GGCCCTCCGAGGGGAACCCCGGGGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved