Ornithorhynchus_anatinus Locus Mono:SNORA52
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SNORA52
Ornithorhynchus_anatinus
Mono:SNORA52
Contig79779
SNORA52
526..630
1136
TCATGAGTTCGACTCCCGGCTTTGCCACTTGTCAGCTGTGGGACTATGGGAGAGTCGCT
TCATTTCTCTGGGCCTCGGTTACCTCGTCTGTAAAACGGAGATTAACTGTGAGCCCCACG
TGGGACGACCTGATTCCCCTATGTCTACCCCAGCGCTTAGAACAGTGCTCTGCACATAGT
AAGCGCTTAACAGATACCAACCTTATTATTATTATTAAAAGCGCCCCCGCCCACAGTGAG
CTAAACGTCCTGCCCCGAGCCCGCCACCCGCCTGCCACCGGGCCTGGGCCGCGGGGCGGG
CTGAGCCACCCGGTGCCCTCTCGCCCTCCCGGCTCGGGTTGGCGCCGTGTCCCGTCTTGG
TTTTCCTCGCCTTCCGGAAAGAGCCGGGAGTCGGCAGGGCCGGGGGGGGGGGGGGACACC
CGGCCAACCTCGCTGTCGGTCGCCCCGCAGGTGATCGGCGAGCTCAACGGGAAGAACATC
GAAGACGTCATCGCTCAGGGTGAGTGGGGCTCAGGCCCGCCCCTCGCCGTCCATCCTAAT
GCCCGCTGGCCGACCGCCGTGCCTGCCGGGTTTCGCTTGTGGACCAGAGCAACCCCACCG
GCCCAGGGACGGTGTTTCCGCGGGGAGACGTCCCCCCGGGCAGGGTGGGACAGGGGCTGC
CCTCCGAGGGGAACCCGGGGGGCGGGGGGGTTCTTCGCCTCGTCTCAGCCGGGAGAGAGT
TGGCGGTCCTGCCCTACCCTTCCCCGCCAGCCCCGAGGGCGGCCTCGGACCCGGCCCGGG
GCCTCCCTCCGACTCCGTCCGCCAGCCCGCAAACATGTCTATCGTCGGGTCACGGGCGGG
AGACGCTCACGTCTCGGGGAGGACCCGCCCGGCCTCGCTGGGATTCCAGAGGCCAGTGAG
GGGGGCCCGACGGACGGTTCGGAAGCGGGGGGGGGTCCCCCCCGGGGGGAAGCTCGACAC
CCCCCGGCCGGACCTCACGCCGCCTCTCCCCTCGCTCGGGTCCCAGGCAACAGCAAGCTG
GCCAGCCTGCCGTCCGGAGGAGCCGTGGCCGTCTCGGCCAGCGCCGGGGCCCCCGCTCCG
GCCGCCGGGGGGTCTGCCCCGGCTGCCGGTGAGTCTCCGCTCTTGAATCCACCACAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved