Ornithorhynchus_anatinus Locus Mono:SNORD14
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SNORD14
Ornithorhynchus_anatinus
Mono:SNORD14
Contig7489
SNORD14
1001..1090
2090
CTAAGTGGTAGAAATGTGACAACTAAGTAAACTCCCCCTTTGGAGGGACAGTATCATAG
AGATTCAACATCAAGGGGCACTCCAGGAATGGTCACTGGGTTTGGGTCAACTGATTCCCT
GGGTGGTCTCAAAACAACATTGTTTTAAGTGCTGGGGTAGATACAAGTTAACCAGACAAA
CTGGGACTCACAATTTAGGAGGGAGGGCAGGTATGGTATCCCCATTTTGTAGATGAGGAA
ACTGGGTCAAAAGTTAATGGTGTCATGACAGTGGTGCTGGCTAAGCCCCTACTGTGCAGC
TCTCAGGCTTGTACTCCATCCACTTGGCCACAACTACCTCTCTTGAGTGACTTATCCAAG
TTCACACAGCAGCTTGTGGTAGAGCTGGGATTAGAACCCAGGTCATTTGTCCTTTGCTTT
CCATGAGGGGGTGCTACTTCTCACAGCTTTTAATTAAAGTGGGATTTCCTTCTTGGGTAT
GTCAGGCACTGGGGTAGATAGAGGTAATCTTGTTGGACATAGGCCCTATCCTACGTGGCT
CAGTGTTGATCACCATTTTAGGGGTGAGAAGTAGGGTGTAGAAGTGAAGTGGCTGGTCTA
GGGTCACACAGACAAGTGATGTAGCTAGGATTAGAACCCACATCTTTTGCTCCTAGACTC
TTAGGAGCTTCTCAGTTGGCCCAGTGGGTAGAGCAGCATATTGCTGCTCTGTTGGCAGGC
AATCACTCATTTAAGCCTTTGGTTCCTCTTAGATGCCAAGCGTCTGATTGGCCGTCGATT
TGACGATGCGGTTGTCCAGTCAGACATGAAGCATTGGCCCTTCACGGTGGTGAATGATGC
AGGCAGGCCAAAGGTCCAGGTGGAGTACAAAGGGGAGACCAAAAGCTTCTATCCAGAAGA
GGTGTCATCTATGGTCCTGACAAAGATGAAGGAAATTGCTGAAGCTTACCTTGGGAAAGT
AAGACCTGCTTAGATTGAATTGTTTTAAGGGTGCTCCTCGATCGCTGTGATGAGTATTTC
CAAAACCATTCGTAGTTTCCACCAGAAGTTGACTAATGATGGCAAAGTACCTTCCTTGGA
TGTCTGAGCGATCATTTGAAGGGCCTTGACTGACTTGAAACTGCCATAATGTATAGCTAT
CCAAGATGGCTGCCCTGGAGGCCATTTTGATCTGTGAGATCTGGTAACTGCCATTTGTTA
CCTAGGCTTTGTGTTGATTTAGGTTGGTATAGTGGGTGCATTTTGCAGGGTATATCTTGA
CTTTCTAAAACCTTCCCTTGCAGACAGTCACCAATGCTGTGGTCACAGTCCCAGCTTACT
TCAATGATTCCCAACGTCAGGCCACCAAAGATGCTGGAACAATTGCCGGTCTCAATGTGC
TCCGTATCATCAATGAGCCAACTGCCGCTGCTATTGCCTATGGCTTGGACAAGAAGGTAG
GCAAAATGGCTGGAATGTAGAGCTGTCTTTCTCTTCCCTCCCCCTCACCCCCCCCCAACA
GTAATTTCAAATTTGAATAGTCACTTAACATCTAAAATTGCCTTGTCTGGCCTAGGTTGG
TGCCGAGAGAAATGTGTTGATCTTTGACCTCGGAGGTGGTACCTTTGATGTCTCCATCCT
CACCATTGAAGATGGGATCTTTGAAGTGAAGTCAACAGCTGGAGATACCCATCTGGGTGG
GGAGGACTTTGACAACCGCATGGTCAATCATTTCATTGCCGAGTTCAAGCGCAAGCACAA
GAAGGACATCAGTGAGAACAAGCGTGCTGTCCGCCGCCTGCGTACCGCTTGTGAGCGAGC
CAAGCGCACCCTTTCCTCCAGTACCCAGGCCAGCATTGAGATTGACTCCCTCTACGAGGG
CATCGACTTCTACACCTCCATTACAAGAGCCCGCTTTGAAGAGCTGAATGCCGACCTGTT
CCGTGGCACCCTGGACCCTGTGGAGAAGGCCCTGCGGGACGCCAAGCTTGATAAATCTCA
AATCCATGATATCGTCCTGGTTGGCGGCTCCACCCGCATCCCCAAGATCCAGAAACTCCT
GCAGGACTTCTTCAACGGCAAGGAACTGAACAAGAGTATCAATCCGGACGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved