Ornithorhynchus_anatinus Locus ENSOANG00000014580
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus ENSOANG00000014580
Ornithorhynchus_anatinus
ENSOANG00000014580
Contig7489
SNORD14, SNORD14, SNORD14, SNORD14
5176..5265, 5663..5756, 6317..6410, 6969..7050
8852
CCCATTTTACAGATGAGGTAACTGAGGCTCAGTGAAGTGACTTGCCCACAGTCACACAG
CTGACAAGTGGCAGAGCCGGGATTCGAACTCATGACCTCTGACTCCCAAGCCCGCGTTCT
TTCCACTGAGCCACGCTGTCACTAGTAGATCCCACCTTTGACAGATGAGGAAAGGGGCGA
AAAGACAAGGCAAGTGACTTGCCTAAGGTCACGGGGCAGTCACTGGGCAGAACCGGGATT
GGAAGCCAACCCAGGACCGTCCCTTTTTCCCTAGGCGCCGCCGCTTTCCCCGTGGACAGG
AGACGGTCTGTGAAGCCCCAACGGAGACTCCTCCTCCCTAGGACAATGGTCCAGACGCCC
CATGTGGCCTGAGGGGATCAGTCCGCCATTTTGTCCCCATCTCATCCCCGTCCCGCAAAA
ATCCTTCGCGCAGGCGCGGTGGCAACCGCCCGCCGCGCAAGCACCACCTCCCCACTGCGC
ATGTCAGGCCCCTCGGCCTCCCTTTCCTCGCTTTTTATCAATACCTCGGCCAGTGCCATG
GCGGGGCGGTTCTCCCCTCTCCCCTTCGCCGTTCACCCCAAGATTAGCTTTCCCCGCCCT
CCCCCGCTTCCGAGGACCGTCTCTCCGCCCTTCCAGAGCAGCCCCGAGGCTTCCCGCGCG
CGGTTTCCCCCGAGCCCCGCCTCTCCTTCCTCTTCTTCCTCCTCCTTCTCCTTCTCCCCC
GCCCACCCCATCCCCAGGGGCCGGGCGCTGAGCGGGGGCGAGGATGAAGGTTCGAGAACG
CAGAGGCTGCGCGTCACAGAGCCGAGGGGCGGGGTGAGGAGGGAGAAGGCGGGTCCAAGG
AGGAGAAGCTGCCGTGGCGATTGGCCCGAGGGCCCCGGCCGGCCAAGGACGTTGGTTAGA
AAGTCAGTGATGGGCGGCGGGAGGGGGCGGATCTGTTCTGGAAGGTTCTGCGAGAGAGTA
TAAAGGGCTGGGGGCGGGTGGAAGCCGGTCTCATTCAACGCAGCGGCAGCCCCGTCAACT
CCTTTCTTGCACAGTATCGGCCCGGATCGCAGGTAACGTACTGGCGGCCTTCGCGGTGAC
TGTTAAGGGGAAGTTTTCTTTTGCGGGGCGAGACCCCGCGGGCGGTTTGCCGGCCCTAAT
GTGGGGGGGGGGGGAGAAGTTAGAAAGCTGTGCTTTATTTAAACCAAAATGGTGAAGTCC
TGAATTCTGCGGTGGGGAGAAGAGGGGAGGGTTGATGCATCACCCAGTCTCCGGCTGCCT
GCCGGGAAAAATAAGATTTCAGCTGAGGCTGAGTGGCTCCCAGGGGCTACGGTGGAGCAA
GATGGCGCGGGGGATGTCGGGGTTCGCAGTCAACTGGGAGTCAAGGGGGTCAAGGAGATG
CTCCCTGAGGGAGGCGTTTTAGTGGACGGTGTGGGTCACGTGGGCTCCCGGTGGCGCATG
CTGGGAAATGTAGTTCTAGGGCCGCCTCTTCCTCCCACCCCCCCGCGGCCTGAGCACATG
GCTCCTCCTCCGCGGTTTTTTTGGTCGCGTGGCCTAAAATCGCTTATGGGCCAAGGCCCG
GGAGAGGCAGCGTGGCTCAGTGGAAAGAGCCCGGGCTTGGGTTCGAATCCCCTTGGCAGC
TGGGTGACCTCGTACAAGTCCCTTCTTTGTGCCTCAGTTACCTCCTGTAAAATGGAGGTT
AACTGGGCCTCACGTGGGGCAACCTGATAATCCCGTATCTACCCCAGCGCTTAGAACAGT
GCTCTGCACACAGTAAGCGCTTAACAAATACCAACATTATTANNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNGCTCTGCACACAGTAAGCGCTTAACAAATACCAACATTATTATTACTA
AAGAGGGCCAGTGGGGATGCGGGGAGAGGAGTCGACCCTTGACCGGTAGGCCTTACTGGG
CAGGTTTGGCACCACGTGCGTGCCCACCTCCCTTGAGGGGGGTGGGAAACCCGTGGTTGG
GGGGGGGCGCGCATCCAGAAGGCCTCGCCGTATGAGGCCCCCCAACCCCGCAACACTTAG
GAGGTGCTATGAAATTACCTGTTAATATTTAGCTCTATTTAAACTAAGATTGTAGACTGC
AAAAGCGTCCATCGTATCGTATTTAGTTCAGCGTTGAACAAGCATTTAATCCTGGTTTTT
AACCAAGCCCCGGCCTGTGCCTTTGCCCTGTGGTGAACGTGGGGGGGAAGGTCCACCGGT
CCATGTGGCTTGGCCAAAAGGAGAAAATGGAGCTGAGACGATGGGCCAGTCGAAAAGCTG
CATTCAAGGCAACCTGACCCTGCTGTTTAGCGGTTTGCCAACCTCTGACGTTTCTTTGCA
GGCACAATGTCGAAAGGGACCTGCAGTTGGCATTGATCTTGGCACCACCTACTCCTGCGT
AGGAGTCTTCCAGCATGGAAAAGTGGAGATCATTGCCAATGACCAGGGGAACCGCACCAC
CCCCAGTTACGTCGCCTTCACAGACACAGAGCGTCTTATTGGTGATGCTGCAAAGAATCA
AGTTGCGATGAACCCCACCAATACAGTTTTTGGTAAGTAACATTCTCAAAATTCAGAAGT
TGCAGGCATGGACTAATGCAATCTGTTAGTGGGAACTGAGTGGCTATTTGCAGAAAGCTG
TGCTTATCCTTAAAGAATGTCCCCGCCCTGGGTGGAAGCCAAGTGGGGCCCTGAGGATTA
AAAAAAGAACATAGTGTATTTCAGTGGGGAGCGGGGAGGGCTCCTGAAGATTCCTTCCCC
ACATGGGTAGGGCAGAAGATTAGTTCAAGTCATAATTCTCGCTTTGCACATGGCCAGGGT
GGAGGGAGGGTTTCCGGAAATGACTTCCGGGTTCAGTTAAAGCAGCCACTTCTCCATTTT
GGAGCAATAATTTGTTTCTAGCCAGGAAATCCACAGTGGAAGTGAACAAACTGGGTGTGA
ACTACCTAACTCCTTATCAGCCTTAGTAACTCAGGCTTTGTTCTAAGTGGTAGAAATGTG
ACAACTAAGTAAACTCCCCCTTTGGAGGGACAGTATCATAGAGATTCAACATCAAGGGGC
ACTCCAGGAATGGTCACTGGGTTTGGGTCAACTGATTCCCTGGGTGGTCTCAAAACAACA
TTGTTTTAAGTGCTGGGGTAGATACAAGTTAACCAGACAAACTGGGACTCACAATTTAGG
AGGGAGGGCAGGTATGGTATCCCCATTTTGTAGATGAGGAAACTGGGTCAAAAGTTAATG
GTGTCATGACAGTGGTGCTGGCTAAGCCCCTACTGTGCAGCTCTCAGGCTTGTACTCCAT
CCACTTGGCCACAACTACCTCTCTTGAGTGACTTATCCAAGTTCACACAGCAGCTTGTGG
TAGAGCTGGGATTAGAACCCAGGTCATTTGTCCTTTGCTTTCCATGAGGGGGTGCTACTT
CTCACAGCTTTTAATTAAAGTGGGATTTCCTTCTTGGGTATGTCAGGCACTGGGGTAGAT
AGAGGTAATCTTGTTGGACATAGGCCCTATCCTACGTGGCTCAGTGTTGATCACCATTTT
AGGGGTGAGAAGTAGGGTGTAGAAGTGAAGTGGCTGGTCTAGGGTCACACAGACAAGTGA
TGTAGCTAGGATTAGAACCCACATCTTTTGCTCCTAGACTCTTAGGAGCTTCTCAGTTGG
CCCAGTGGGTAGAGCAGCATATTGCTGCTCTGTTGGCAGGCAATCACTCATTTAAGCCTT
TGGTTCCTCTTAGATGCCAAGCGTCTGATTGGCCGTCGATTTGACGATGCGGTTGTCCAG
TCAGACATGAAGCATTGGCCCTTCACGGTGGTGAATGATGCAGGCAGGCCAAAGGTCCAG
GTGGAGTACAAAGGGGAGACCAAAAGCTTCTATCCAGAAGAGGTGTCATCTATGGTCCTG
ACAAAGATGAAGGAAATTGCTGAAGCTTACCTTGGGAAAGTAAGACCTGCTTAGATTGAA
TTGTTTTAAGGGTGCTCCTCGATCGCTGTGATGAGTATTTCCAAAACCATTCGTAGTTTC
CACCAGAAGTTGACTAATGATGGCAAAGTACCTTCCTTGGATGTCTGAGCGATCATTTGA
AGGGCCTTGACTGACTTGAAACTGCCATAATGTATAGCTATCCAAGATGGCTGCCCTGGA
GGCCATTTTGATCTGTGAGATCTGGTAACTGCCATTTGTTACCTAGGCTTTGTGTTGATT
TAGGTTGGTATAGTGGGTGCATTTTGCAGGGTATATCTTGACTTTCTAAAACCTTCCCTT
GCAGACAGTCACCAATGCTGTGGTCACAGTCCCAGCTTACTTCAATGATTCCCAACGTCA
GGCCACCAAAGATGCTGGAACAATTGCCGGTCTCAATGTGCTCCGTATCATCAATGAGCC
AACTGCCGCTGCTATTGCCTATGGCTTGGACAAGAAGGTAGGCAAAATGGCTGGAATGTA
GAGCTGTCTTTCTCTTCCCTCCCCCTCACCCCCCCCCAACAGTAATTTCAAATTTGAATA
GTCACTTAACATCTAAAATTGCCTTGTCTGGCCTAGGTTGGTGCCGAGAGAAATGTGTTG
ATCTTTGACCTCGGAGGTGGTACCTTTGATGTCTCCATCCTCACCATTGAAGATGGGATC
TTTGAAGTGAAGTCAACAGCTGGAGATACCCATCTGGGTGGGGAGGACTTTGACAACCGC
ATGGTCAATCATTTCATTGCCGAGTTCAAGCGCAAGCACAAGAAGGACATCAGTGAGAAC
AAGCGTGCTGTCCGCCGCCTGCGTACCGCTTGTGAGCGAGCCAAGCGCACCCTTTCCTCC
AGTACCCAGGCCAGCATTGAGATTGACTCCCTCTACGAGGGCATCGACTTCTACACCTCC
ATTACAAGAGCCCGCTTTGAAGAGCTGAATGCCGACCTGTTCCGTGGCACCCTGGACCCT
GTGGAGAAGGCCCTGCGGGACGCCAAGCTTGATAAATCTCAAATCCATGATATCGTCCTG
GTTGGCGGCTCCACCCGCATCCCCAAGATCCAGAAACTCCTGCAGGACTTCTTCAACGGC
AAGGAACTGAACAAGAGTATCAATCCGGACGAGGCTGTCGCCTACGGTGCAGGTAGCTTG
TCCTGAATTGTCTTGGGCTCCCCTGGGAGGAGGAAACCCAGCCGGCCTGGGATATTACAC
TTCCACCAATGTAGTATCGCTGTGATGAATGCTTCCAAAACCATTCGTAGTTTCCACCAG
AAGGTGACTGATGATGGCTAAGTTCCTTCCTTGGATGTCTGAGCGAGACTCCCTCATGCT
CCTGGGGTCATTTTGGGTTTCCCCTGGTCCATTGTGCTAACTTGTTTGCTCTTTTCTTTC
AGCTGTCCAGGCAGCCATTTTGTCAGGAGACAAGTCTGAGAATGTGCAGGATCTTCTCCT
GTTGGATGTGACCCCCCTGTCCCTGGGAATTGAAACCGCAGGAGGAGTCATGACTGTCTT
GATCAAGCGTAACACCACCATCCCCACCAAGCAGACACAGACTTTCACCACCTACTCAGA
CAACCAGCCAGGTGTACTCATTCAGGTATGTCTTTAGACAGGACCTGATTGCACCCTTGC
TATCCCACCTCTTCGCCTGAGCAGTCTATCCAAAGGTTGGACTGCCTGGCTTGGTGCCCA
GCTGTTGCTACTTAAGGCTCTTGTCGCTGTGATGAAAATGACCCCAAACCATTCGTAGTT
TCCACCAGAAGTTGAGACATGTGTTGGCCCAAGTTCCTTCCTTGGATGTCTGAGCGACGA
GTCTGTTCCTCCATCCCCACTGCATGAGTTGGCTCATCAGGCTGACCTGGTTTCCGCCTT
GCCCCCTTTTCCCCAGGTTTATGAAGGTGAGAGAGCCATGACCAAGGACAACAACCTGCT
TGGGAAGTTTGAGTTGACGGGCATCCCTCCTGCCCCCCGAGGCGTGCCTCAGATTGAGGT
CACCTTTGACATCGATGCCAATGGCATCTTGAATGTGTCTGCTGTGGACAAGAGCACAGG
CAAGGAAAACAAGATCACGATCACCAATGACAAAGGTAAGTTGGGGGCTTTAATTCTGGT
ATGAAGAGCTTACTGTGTGCTAGGCACTGTTCTAAGTGCTGAGGTAGAAGATAGCTTGTA
CACAGTGCTAAATCTCCATCTTACAGATAAGGTGATGTGGCAGAATTGGGATTAGAACCC
AGGTTCTGATTTCTCGGGCCCATTTTCTGTCCTAAGCCACACTGGATTTGAGTGGGTGGG
GATCAGCCATCTGGGCCAGGTCACATCACCTGACACAGGACACAATACCTTGGAAGTGGT
GGGAAAAGTCCAGGGGCCTGCTGTGATGCAATGTTCCAAACCATTCGTAGTTTCCACCTG
AAGTCCCGAGACTCATGTTGGCTCAAGTTCCTTCCTTGGATGTCTGAGCGGCTGGACTTA
ACCACTACTGTTTTGGAATGCATAGCTAGGTCAAGCACTTGTGATCCTTTAGTGACCGTT
AGCCTCTTACCCCCATCTATGCAATGATTCTAACTGGACCAAAACACCTCTTGCCACAGG
GCGTCTGAGTAAAGAAGACATAGAGCGCATGGTGCAGGAGGCAGAGAAGTACAAAGCTGA
AGATGAGAAGCAGAGAGACAAGGTGTCTTCCAAGAACTCCCTCGAGTCCTATGCTTTCAA
CATGAAGGCAACTGTTGAGGATGAGAAGCTCCAGGGCAAGATCAGTGATGAGGATAAGCA
GAAGATCCTGGACAAATGCAACGAAATCATCAACTGGCTGGATAAGAACCAGGTATGGCT
GGCAGTCTGCCTGGCTCATAACTTAGAACCCACAGTAGGAGGATTTGAGTGTCCAGTGAG
TGTTTCACTGTAATTGCCCACAAAAAGCAGCAGGGCCTGAAATCCTGACTCCTGGAAGGG
TTTGCAGTCTGACTTAGTCACTCTAAAACATGAAGGGTATCGGTTGGGACAGTTTTGGTA
GCTGTATGGTTGCTATGATAGATTCCAAAACCATTTGTAGTTTCCACCAGAAGCTGACAC
ATGTTGGCTTAAAAGTTCCTTCCTTGGATGTCTGAGCGACTAGAACTAGTGTCCTATCCT
CCCTATAGTGCTGTTCAGGCACTGTGTGTTGGAGCCAACTTGGCTCATCTCTAAAGCCTA
GCTCCCAGCTTAAATGACAAAATTGAGCAGAGCACTGTACTATTAAAGTACTAAGTTGGT
ACGTTCCCTACCCTCAAGGAGCTTATTCATGTGTAGCAGGAGGATCTTGTGCCCCTGCTT
GCTGCCCTTACAGGATAGTAAGGAGATGGGGTTTCCTGCACCTGCCCATGGCTTTCTGCT
CTTCAGTCTTGGGGATGGGGGCCACTTAACCAGGGTCTGGCCAGCAAGGCTCCTGTGGCT
TGAACTCCCTGACCTGTTTTCTCCTCCCCTGTTTTGAACAGACTGCCGAAAAGGAAGAGT
TTGAACACCAACAGAAGGAGCTGGAGAAAGTGTGCAACCCCATCATCACCAAACTGTACC
AGAGTGCAGGTGGCATGCCCGGCGGGATGCCCGGGGGCTTCCCTGGTGGTGCAGCCCCTC
CCTCTGGCGGAGCATCCTCTGGCCCCACCATCGAGGAGGTCGACTAAGCTCCCCAGGAGA
AAGCATGTTCCACACCAGGCTCTTCACCACTCAGAAGGACCCCAATTTGGAGCTGGGCTG
GGTGCAGCAGCAACTCAAAGCTCCCCTTTGAGGTGCTGGGTCATCTTTCCAGGCATTCTG
AATACTTGAATGTACACAGGGAGAGGAGTAAACACCATCGCACTTTATCAGTACTGTAAA
CAAGTGGAAATGCAATTCATGTCCTGAACAATAAATCCTATTTAATTGGCACCATACAGC
TGAGTCTGACTCCTGGTGTTGCCCCACATTCGTCCTTTAGATCCCCTGCCCATCTACGGT
GCACTGCCATGCTGCCCCTAAACAGCTACCATCTAGAACATAGAGCTGGGTGGGTTCTGT
CTTTTCCTGTTTACTGGTCCCCTGACATAGGAGATAATGGCTTTACTGGATGGAGTATCC
CTCCTTTCCTGCTATCTTTCTCATCCTTGCCCCACCCCCTACTTAAGGTGATGGTAAAGC
TTTGGGCTGCAAAAGATCCCAATAAGGTTGGTTTGGGAATTTGGTAGGCAGGTGTTGGCA
CAGGAGGGATCCGGTCTGCTAGCCAGTACACCCTTGCCCTGGTGGGAAAAAGACACTGGG
AATGTGGTATCTTCTTGGTGTGTGTGTTAACCCCTTCCCCCCTGCTCCTAATTAAAGTTC
ATGGGCACCAGAGGATGGTGGGACTGGGATTAAGCCCTAGATCTGTACTCAGGCCAATTT
GTTCCTGGGGAGGCATGACAACTGGCTCCCAGGAAATCCCAATTTATGTAAGTGGTCTGG
TCTGGAAAGGTTTTGTTCTTGTTTTGTTTTTTTTAAAAATCCCTCCCCCATGAAGGGAGG
GGAAAGTGCCTCCTTTTCTAAGGTAAGTTGGAAGTAGCTCCCAAGAGGACTTTTTCCCCA
GGATAAGTCACCCCTTAAACCAGCTGAAATGAGTTCTGGGGTGGATTGGAAAAGTGCGAG
GCAGCATCTTGCCTCTGGCCTGGAGTGCCCTCCCTCATCTGAAGGGCCATTCCTTTTCCC
CGACTTCCAAGCTTTACTGAAGGCACATCTCCACGAGGCCTTCCCTGCCTAAGCCCCCCT
TCCTTATCCCACTTCTGTGTTGCCCTAACTTGTTCCTTTTTATTCATCTTTCCTCACAGC
ACTTTATATACATATCTGTAATGGTATTGTCTTCCTCTCTCATGGGTTATGTTGTCTGTT
ACTGCAATCACACAAATGCTTATTATAGCTCTC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1051, 2341..2551, 3733..3938, 4264..4416, 4536..5091, 5342..5544, 5836..6034, 6539..6771, 7421..7852
2527..2551, 3733..3938, 4264..4416, 4536..5091, 5342..5544, 5836..6034, 6539..6771, 7421..7606
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved