Ornithorhynchus_anatinus Locus Mono:SNORA7
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SNORA7
Ornithorhynchus_anatinus
Mono:SNORA7
Contig73797
SNORA7
198..335
1325
ACTTATATATTAATTAAATTTTTTATTTTGATTTTTTTGGAATGTTTAATCATGGTGCA
GAGCACTGTACAAAAGGGGCTTGGGAAAAGTACAGTACAAACAGGCGTTGGGGAGATGTG
ATCGCCACCCCACTATGAGCTTACAGTCTGGGAGGGGAAACAGACATTGATATAAATAAG
ACAAGTGTAATGTAACAAGGCTTCTCAGGGTCACACCTGGAGAGTTCCCAGTACTCTACA
AGTCTTGACTACAGGAGGAAGAGATAGGCGGAGGTGTATCTATCCCATTCCTAGCTTGGG
CAGTGGCTAGCAAGTGGAAGGGAATCTGCTACAAATCAAAAGTACCCCGTGTGGGGCTGG
AGGAGAATCAACGGAGAAAACTCAAGTTTATTGCATGGAAGGATGCGATGGTAAACCACT
TCCGTATTTTGACCAAGAAAACTCTATGGATGCACTACCAGAATGATTGCAGATTGAGGT
GGGGTGATCTAGGTTACATTTGTCTATGGTGTCGCTGCAGGTCAAAGAAGACTCGACAGC
ATAAGATAAGACAGTGTCGCTGCCCACAGTGAGCTAGAATGGCAAAACAATGAGGATAAG
GCCCATCAATCAGTAAATGGCATTTATTGAGCACTAACTGTATGCAGAATGCTTGGGAGT
CAGAGGTCGTGGGTTCTAATCCCAGCTCCTCCACTTATCAGCTGTGTGACTTTGGACAAG
TCACTTAACTTCTCCATGTCTCAGTTGCCCAACCTGTAAAATGGGGATTAAGACTGTGAG
CTCTAAGTGGGACAACCTGATTACCTTGTATCTACCCCAGTGATTAGAACAGTGTCTGGC
ACATAGTAAGTGCTTAACAAATGCCAGCATTGCTATTATTATTAACAAAGGCACTGTTAC
CCGAGGAAGGGAGTGGGGGAATCAGTCACATCCAGTTGGAATGCAGGGAAGGAGGGAGTG
AGGGCTCCCCAAAGATGGTCACTTTTATGGGGAGGTACTAGTGAACACAAAGTCCCATGG
CCCTGGTCAGAGGGGGAGCTGGGGAACACAATTCATTCATTCATTCATTCATTCATTCAA
TAGTATTTATTGAGCGCTTGCTATGTGCAGAGCACTGTACTAAGCGCTTGGAATGTACAA
TTCGGCAACAGTTAGAAACAATCCCTGCCCAGTTACAGGCTCACAGTCTAAACAGGAGAG
ACAGACAGCAAAGCAAAACAGAACAAAACAAAAACAAGACAACATCATCAAGATAAATAG
AATCAAGGGGATGTACACCTCATTAACAAAATAAATTGGGTAATAAATAATATATACAAA
TAATAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved