Ornithorhynchus_anatinus Locus ENSOANG00000010001
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus ENSOANG00000010001
Ornithorhynchus_anatinus
ENSOANG00000010001
Contig704
SNORA55, SNORA55, SNORA55
9088..9221, 10353..10487, 16145..16284
20076
CTGTCTGTCCTCAGCCTGATCAGCTTCCACCTCGTGTCCTGCTGTCCGTCCTCATCCTG
ATCAGCTTCCACCTCGTGTCCTTCTGTCCATCTCCAGCCTGATCAACTTCCACCTCGTGT
CCTTCCGTCCATTTCCAGCTTGATCAGCTTCCACCTCGTGTCCTTCTGTCCGTCCCTGGC
CTGGTCAACCCAACCGCGTGTTTGTCCATCAGTCTCCCCCTGGCCTGGTCAGCTTCCTCC
TTGTGTCCGTCCCCCACCTGGTCAGCTCCACCGCGTGTCTGTCCACCTGCCCGTCCCTGG
CCTGAGCAATCGCCGCCTCCGACTGCCCCCCTCGTCGGAAGAGTATTTACTGTTTCTTTT
ACTCGTATTATTTAAACCCCCGAAATCGAAGAGTTATATTTATAAGAGGAGAAATATTAT
TTAAAGAGAAAGACGTTTATATTAAAAAAAAAGCCTTCTATTTAAAGAACTTATTTTGGG
GGCCTTAGAGTCCAGGTTCGGAGAAATTCGGGGTGATAGGGAAAAAGCGTAGCTTCAAAA
GGAATACACGGAAAAACAAGTTTTAGCCAGAAAGTTTGAAAACCGTGAAACACCGAGGAA
AAGGAGAGGGGAGGTTTCTGTTATCTGGTGGCTTTTGAGACTCATATTTGAAGGTTTCTG
TTTCTTTTTGGTGCACAGGACAGCCTTTGCCCCTGCCATCTGTCCTGTGGCCCACCAGAA
AAAGCTTCACCCTCATCCCCCCAAATTTTCAGTTCATCACCAGTCACCACCCCCTTGCAG
TGCAGATTGCTTTCTTGCGTCGTCTTTTCCCTTCCTACCCTGATTCCCCACCTATCCTAA
CCTCTTAAATGTTCTTCTGCCTTCTCTAACCAGCTTCGGGTTAAGATTTTTTTAAGCAGA
TCGCCTCCTTTCCCGGTTTGGTTTTGATTTATTTTTCCCCCTTGCTCGTCTCCCTCAAAG
ACTGACTCCTGGCGGGGCTCGGGGTTTTGGGCGGTGGGGAGATGAGCACCACTGCCAGTA
GCTATCCGATGGCATCTCTCTATGTGGGTGACCTGCACCCCGATGTCACAGAGGCCATGC
TCTATGAGAAGTTCAGTCCTGCAGGGCCTGTCCTCTCCATTCGAGTCTGCAGGGATATGA
TCACCCGCCGCTCCCTGGGTTATGCATACGTCAACTTCCAGCAGCCAGCTGATGGTGAGT
ATGGAGTGTGTAATAATGCTGATAACCAGGGTATTTGTTAAGCACTTACTACGTGCCAGG
CACTGTAGTAAGCACTGGGGTGGATAATAGCAAATCAGGTTGGATGCAGTCCCACGTGGG
GTTCACAGTCTCAATCCCCGTTTTACAGATCAGGTAACTGAGTCCCAGAGAAGTGAAGTC
CCTGTTTCCCGTTCCACATGGGGCTTCCAGTCTTAATCCCTATTTTACAGATGAGAGAAC
TGAGAAGTTAGTGACATGACAAAGGTCACAAAGCAGACAAGTGGCAGAATCAGGATTAGA
ATCCAGGTCCTTCTGATTCTCAGGCTTGTGCTTATATTAAGTGCTGCTTTTTCATCCAGG
GTGGCAGGGAGGGCTGCCACCATCTCTTTTTGGCAGCGCCTCTAATGTGAATTTCTGAGG
CTCAAAGCTACTTATAACTAAAACTCAAACCTGACAGTTCAGGTGACAACTTTTACATTG
TTCCGATATAAGCAGAGTCACCCGTTTCTGTGAGTTGGGGAAGAAGTTAGACGAATCCTG
AGTAGATAGCCGTCGGAGAACCCTGAGAAGGGGCACATCAACATTTATTGAGCTTTTATT
GTAGGTAGAGCCCTGTACTAAACCAGTAGGAGAGGATAGTTGAGTTATACGTAATTTCTG
GCATCAAGGACTTTATAATCTAGCCATAATGGCCTGAATGTGTTGAGGATGGGCGTGTTG
AATGGGTGGCTGGAAATAATAGTAATAGTAACAGCATCTATTGCTATCCCCTCAGCACAG
TGCACTGTACTAACCACTTGGGAAGTATTCAACAAGAAAGTTACCCATTTCCTGCCCACA
AAGAGCTGAAACTCTGGTACCAAAAAACATTCTCAATCCTCCTAAACTGTTGCATTAGAG
AAAATCCAGCAATGAAAGCCTCTTCTGAAGCAGTGGGAGACACCTGTTAAATGGTATTTA
CATGTTTATTGTGCCAGGCACCGGCCTAAACACTGGGGTAGATACAGAGTTGGGCACATC
CACGTTCTACGTGGGACTCCCAATCTTAATCCCCATTTTGCAGATGAGGTAACTGAGGCC
CCAAGAAGGGAAGCGATTTACCCCAGGTCACCCAGCAAACAGGAGGCAGAGCTGCGATTA
GAACCCAGGTCTGCTGACTCCCAGGCGCGTCCCATGTCCACTGGGCCACGCTGCTCCTTT
AACTCCTAGCATCTCCAACATGCTGATAGGGAAATTGAGTTAGCCACGGTCAAGATAACT
AATCACTATCAAGTCCTTTCTGCCTTTCAACTCAGGATGAGCTCAATATAAGGGGAATAG
CATGGACTTCTTTATTTTGGGGGGGAGGAGGGGACACGTGGGGATAAAGCCCTCTTCGGT
GCATATTTTAGCTCAAACTCGTCGTTACTTTTGACCGAGAATTTGGTTGCAGTTAGGGGT
AACTGTTGGATTTGTGCTTCTGCCAACACATAGCTCCAAGGGCCCTCTCTCCCTGCTATA
AATAAATATCGCTGCCAAATCTGACAGACTAGGCCGAGTCGCCGTCCTCAGCGCCTTCTT
GAAACAAGCTGCTACGTTTGTAAGTCCGGTCGCTTCTATCCAGTGGGGAAAGAAGGAATA
AACCCTTAAGTTAGGGCCCAGAGGGGCCGCGGTGGATGGAAATTTCAAGATACGGCACTT
ACCTGAACGCTCTCTCGGGGTAAATATTCCTGTGGCGTTTTTCAGGAGCTGTGGGTTTTT
CTTTCCCTAATGGCTGCAGTGATGTTTGAGCAGAATGTTCCTATTATAAATTGAGAAATA
AGGGCGGTGGTTGTGAAGCGGGAGAAGGGGTGCAAATACTAGCCGGAGAAGCCTTTTCTG
TGGCATTTTGCCCATGGGCGTCTGCTTCGTTCATACCGGCTGTTATCTGAAGGGCCAAGA
CTCGGTGCAGAAAAATTGCTCGCCCTGTTTCTCAGTGCCAAACAGCAACATGAGCCAATG
CTTTCCAACAATGTGAACCCCTTACGCCTATCTGAGGTTATTTGACAGCTGGAACGATCA
ATCAGTGGTATTTATTGAGCACCTGGTAGAGTTCAGAGCGCTGTACTAAGCGCTTGGGAG
AGTAAAGTAAAACAGTGTTGGGAGACAGTTGCTGCCCACGATGAGATCACAGTCTAGATG
CTGAAGATTTGAGCTGCAGAAGCCTGGTGAAGTTTCTACTCACAGGTCCTTTTGACTCCC
AAGATTGTGATCTATCCACTAGGCCACACTGCTTCTCTCGTATGCCTAGGAAAGTGCTTT
GCACCAAGCTGGAGCTCAGATCCCTGTGAAAACCTGAGTGGACTTATGATTTCTTCGGGG
CTGTTGGGTGATATATGGAAATAGTTCTGCAGATATGTTTGGTGTCTGATTCCTTTCAGT
ATTAGTGCAGGGCCCTGTACTAAGCGCCTTTTATTTCCGAACTTGGCTTCTGCCAACCCT
GACCCCACCTTTTAAGGGGATTCTGATGACATTTGGCTTTAAGGCAATCAATGACATTTA
TCGAGCACTTAGTATGTGTAGAGCATCGTAGTAAGTGCTTTGGAGAGTTCAGAATAACAG
AATTGGTAGACACGTTCCCTGTCTAAATAAAGTTCACAGTCTAGAGGGGAGGTGGACATT
AGGAGATAGAGAAGCAGCTTGGCGTAGTGGACAGAGCCTGGGCCTGGGAGTCAAGAAGGA
CCTGGGTTTAAATCCCAGCTCTGCTACTTGCCTGCTATATGACCTTGGGCAAGTCTCTTA
ACTTCTCTGGGCCTCAGTTCCCTCATCTGTAAAATGGGGGTGAAGACTGTGGGCCCCAAG
TGGGACAGGGACTTTGTCCAGCCTGATTAGCTTGTATCTACCCCAGCGCTTAGGACAGCA
CTTGACACGTAGTAAAGCGCTGAACAAGTACCACCAAAAAAAGGATTTGGAGCCCATGTG
GGACAGGAATGTGTCCAACCGGATTAGCTTGTATCTATACCAATGCTTAGTACAGTGTCT
GCTACATAATAAGCGCTTGACAAATACCCCCAAAAAAGATATAGACATTAATATGAATAT
TAATCAAGTCCCAAGTGAATGGTGACATTTCCTCTTGCGGCACTGAAAAGATTGGGATGA
TTAGTTTGGAATTTGCCATTGGAGTTGGAGATGCCAGCGTTACAGGGAAGTTCGAAGTGA
CCTGGCAAGACCCAGCTATCTGGAATTCTCTAGTCCCCACCACCATCCCCACCCACTTGC
TCCATCTCAACCCTTTCTCCTCCCCTCAGCTGAACGCGCCCTGGACACCATGAATTTTGA
TGTGATTAAAGGCAAGCCCATCCGCATCATGTGGTCTCAGCGGGATCCTTCGTTGAGGAA
ATCTGGGGTTGGCAATGTCTTCATCAAGAATCTGGATAAATCCATAGACAACAAAGCCCT
CTATGACACCTTCTCGGCGTTCGGGAACATCTTGTCCTGCAAGGTGGGTCCTGGTCATCC
CCTGTATGCGTGAATCGGTCGTATTTGTTTAGCGCTTTCTGGGTACAGGGCACTGTTCTA
AGCACTTGGGAGAGAACAGTATAACAGAGACGGTTCCCTGCCCACATGGAGCTTAGTGTC
CTCACCCCTGGCTTTAAAGCACTCAGTCACCTTGTCCCCGCCTACTTCACCTCTCTACTC
TCCTACTCCAACCCAGCCTGCACACTTTGCTCCTCTAATGCCAGCTTTGTCACTCTTCCT
TGACCTCATTTATCTTGCCGTTGACCTCACTCACGTCCTGCCTCTGGTCTGGAATGCCCT
CCCCATTCATCTGACAGACAATGACTCTTCCCCCCTCCTACAAAGCCTTATTGAAGGCAC
AGCTTCTCCAAGAGACCTTCCCTGACTAAGCCCTCTTTTCCTTTTCTTCAGTTCCCTTCT
ATGTCGCCTTGACTTGCTCCCTTTATTCATCCCCCCTTCCAGCCCCACCCTACTTATGTC
CATATCTGTCATTTATTCATTTCTTTTAATGTCTGTCTCCCCACCTAGGCTGTAAGCCCT
TTGTGGGCAGGGAATGGGTCTGCTTACTGTTCTCCTGTACTCTCCCAAGGAGTTAGTACA
GTGCCGTGCACACAGTAGGTACTCACTAAATAAGATGGTCTTGACTGACCGAATCGCAGT
CTCATGCCTGGCCTCAATCAGGCTGTTCTCCGCAGGCCCCGGGCGACTCACTTTTTCTGT
CCCATTCCCCATAGGTGGTGTGTGATGAGAATGGCTCTAAGGGCTACGCGTTTGTGCACT
TTGAGACCCAGGATGCCGCCGACAGGGCCATCGAGAAGATGAACGGCATGCTGCTCAACG
ACCGCAAAGTGTGAGTGTCCCAGCCAGGAGCCACAACGATCGCATGTGACCCGGGACGCA
TCGCGGTATTAACAGGGACACCCAAGGCTACTGGTTCTCTCGGCCCAAGCCGTGGCCTGC
CACCTCTCCACTACAGGGCTGGTGAGTCTCCCTGCCCAAGTCGAGGCCCGCTGTTTCTAC
ACTGCTGGGCTGGTGGGTCTCCCTGCCTGGGCCTTGGCCTGCTACCGGTCCGGTCTGAGG
ATCAGTGGGTCTGGTTGGGTCGGTGCTCTGGGCCCATAATAATAATAATCTTGGTGTTTG
TTAAGTGCTTACTCTGTGCAGAGCACTGTTCCAAGTGCTGGGGTAGGTACAGGGTAATCA
CGTTGTCCCACGTGAGGCTCACAGTCTTAATCCCCATTTTACAGATGAGGTGACTGAGGC
ACAGAGAAGTTAAGTGACTTGCCCATAGTCACACAGCTGACAAGTGGCAGAGCTGGGGTT
AGAACCCATGACCTCTGACTCCCAACCCCGGGCTCTTTCCACTGAGCCACGCTTATCCTT
CCCAGAATGCTCAGATTGGTTGGGGGGGGGGGGGCATTTCTGTGGATCATGGAGGCCTAC
TCCCCTTTGGCCATGATGGTGGGTAGGAGATTAATCACCTTTATTTAGTGCCTGCCATCA
ATCAATCATTAATAGTTAATAATAGTAATGGTAGTTAAGTGCTTACTATGTGCCAAGCAC
TGCTCTAAGCATTGGGGTAGTGGAAGTTAGTTTGGACACAGTTCCTGTCCCATGTGGGAC
TCACACACTCTTAATCCCCATTTTTTACAGGTGAGGTAACTGAGGCACAGAGAAGTGAAG
TGACTTGCCCAGGGTGACACAGCAGACATATGGTAGGGCTGGGAATAGAACCCATGACCT
TCCGACTCCCAGGCCTGTGATCTATCCACTCCACCATGCTGCTTCCCTATAGAGCGCTTA
CGGTGTGCAGAGCACTACAACGCGCTTGGGAGAGTACAGTGTAACAGAGTTGTTAGGCAT
GTTCCCTGCCCATAGGGAGCTTTCAGTCTAGCTTGCCCTGCGCAGAGCACTGTGTTTAGC
ACTTGGAGAGGACAAACGGTGGCCTATCAAGCGCTTAATATGTGCCAGGCACTGTTCTGA
CCCTCAGGGTAATCAGGTCCAGTCCTCCATGGGACTCCCAGTCGAAGGTACAGTAGAGTT
AGCCTGATTTTTGCTGTTGGAGGGTCTCCTTGTCTGCTTCCATTTGGCTGTGGTGCTTGA
TGATTTGTTCCTTAGGATGGGTAACTCTCTTGCTTGGGTCTCAACTTGCTGCCTCTTCCC
AACGGCTTCTAGAAACATCCTCACTTCCGACCCGTCAGCCCACCGTTGACCCCCACCTTG
GGTGCACCCTAGAGTTTCTCACGTGCTGTGGTTTGTTTCTCCCCCCAACTTCAGGTTCGT
GGGTAGGTTCAAGTCCCGAAAAGAACGGGAGGCCGAGTTGGGAGCCAAAGCCAAAGAATT
CACGAATGTTTATATCAAAAATTTTGGGGATGACATGGATGACGAACGACTGAAGGAACT
TTTTAGCAAATATGGTAAGTTTGGGAGTTAACTGGAATTGTTGCCTTTTTTTACTCTAGT
GTCTGCAGACTGTAAGCTCCTTGCGGGCAGGGAACGTGCCTACCAATTCTTGTTATATTT
GTACTCTCCCAAGCGCTTAGGACAATGCTCAGCACACTGTAAGTGCTCAATAAATAGGAT
TAACTGATTGATAGTGATATCTTCTCCCAACCATGGCTCTGGTGCCGTCTTGGAGTCAGG
TCGGAAATTCCAAGCCAGAGTCTCTTGAAAAACATTGCTGAGGTGTAGGTTGATGGGATG
AAAGGGCTTTGGGGTTGGATTGGGGAAGAGTATATAGGTTTAGGTTTAGGCTTGATTTAA
TGATAATGAGCACTTACTGAGTGTTTGGAACTGTACTAAGTGCTTGGGAGAATACCACAG
TGTGCAGGTACGTTCCTTCCCCTCAAGGAGGTTACTATGTAAACTCTGACATGGAGATTT
TCTCCTTGAAGCGGAGGGCCTCGTGCTAACATGATTTCTTGGCAACAGGTAAGACCCTGA
GCGTAAAGGTGATGACAGACCCCAGTGGGAAGTCCAAAGGCTTTGGCTTTGTGAGCTTTG
AAAAACATGAGGATGCCAATCAGGTAAAACCGGCTTTAGTTCCCCACAAATTTTTGTTGG
AAAGCTTGCGTTCGGTGCTGCATGCTGTGATAGAGCAAACAAGTTGGAAAAAGTCAGAAA
AGCTAAGGGTCATGAGGAATTCTTAGCTACGTTCTTTCTCTTTATTGGAGGTGCCCAATT
TTCAAGGCACTTTCACATTGCTGATCACATTTTATCCCTGTCAGGAAGGAGAGACCAGCA
CTACTGTCCCTCTAGACGTATCTAAGGAAAACTGAGGCCCATCCAAGTGTTATGACTCAT
AAGCTCATGCTCTTTCCACTGGACTGTACTACCTTATCCTGTGGGATCAAAAAGCCTAGG
TTATAAAAGGGGAAGCAAATAACATGATGAACAAAAGGTGAGGCCCCTTGGAGTCTGAAG
CCCGATGACAGTCAGTTGTCAGTGAAAAAGAAAGTGGGTTTGAAATCATTTCTGAGTAAG
GTGGTTACTGCATTTAATGTTTCCATAGAGTGCCTTGCCCTAAGCCAATCTGTTGGTTTT
ACCAAGGTCAGTTTCTCAGAAGGGACACATGAACTGTGAAAGTCTGTAAGGACTAATTCT
TATGTAATCCCAGCGCTTAGAACAGTGCTTGACGCATAGTAAGCATAGAGCAAATGCAGC
CATAATAATAAATACTAAAAAGAATGAGGAGCCGTGAAGCTGGTCTAGACAGACTTGTTC
GTCTTTTTCCTGAGCAGGCAGTCGAAGACATGAACGGGAAGGACATCAACGGGAAAATGG
TATTTGTCGGCCGGGCGCAGAAGAAAGTCGAACGCCAGGCTGAGCTCAAACGGAAATTTG
AACAGCTGAAGCAAGAAAGAATCAGTCGCTACCAGGTGAGGTGGCCAGCGTTCCCTCCCC
AGCTGGATGGCCGGGATCGCCTTGGGCCAGGTGCCCAATGAAATGGTTCCTTTTCTCCTG
CAAACTTCCGGGTGCTCGTTTTCCTTTGAAAATAGCAAAATTGTGAGCACACTTATTTCA
AGGACATGTATAATAACGATGATAATGATGATAATTGGTTTTAGGCGCTTGCTATTTTTC
AGTCACCCAAGTGCTGGGGTAGATACAAGGTAATCAGGTTGGACCCTGTCCCACATCATC
TTAAGTGAAAGGAGAGGGTGGGTTTTTAATCTCCATTTTACAGACTAATAGTCTGAATGA
CTGGCCCACAGTCACATAACAGGTTGGTGGCGGAGCCGGGATTAGAATCCAGGTCTCCTG
ACTCCCAGCACCACGGACTGAAGAGAATCTGTCCCACTTTTCTGTTGCTGTAGTCTCCCA
AGTACAGTGCTTTGAACACAGTAAGTGCTCAATAAATGCAATGCTCAGCCCTGATTGAGG
GCCTAATAAATATCCTTATAATAACATCGCACCTAAATCTTTCCCACTCCTGTGACCCCG
TGCGGGAGTGGTGACAAATGGTGCTACAGAATGGCAGAGGAAATCCAGACAGGTCGCTAC
ACCAATCATCCAGGCACCTGTCCCTACAACTCTGCAACATGTGCTCCTCCGTTGGGAAGC
AGTGTGGCCTAGTGGAAAGAGCAGGCCCAATAGAGGCCTTTCGTTCTAATCCCGGCTCTA
CCAACATACCTGCTGTGTGATCTTGGGCAAGTCACTTTATTTCTTTATGCCTCAGTTCCC
TCATCTGCAAAATGGGGTTTTACTACCCTTTCTCCCTCCTACTTAGACTTAGGCGGAACC
CGATTGTCTTGTATCTACGCCGGCATTTAATAGAGTGTTTGGCACATAGAGCTTAACAAG
TACCATCATTATTATTATTTCAGTGGTATTTGTAAAACACTAGCTAAATGTCAAGGACTG
GACTACGTGCTGGGAGAGAGACATGTTTATCAGGTTGGACATAGTCCCAGTCCCACATGG
AGCTCACAGTCTGAATTGGAGGGAAGAGGGTTTAATTTTCAATTTATAGATGAGATAACT
GAGGCCCAGAGAAGCAAAGTGACTTGCCCAAGGTCGCACATCAAGCAATTGGCAGAGCCG
GGGAAGAGAACCCGGATCCTCTGACTCCCTGACCCTTGTCCTTTCCACTAGGCTATGCTG
CTTCTTCAACTTCTTAGTCTGTTAGGGATTCTTTGTTAAGTAGTTTGACTTGCTGAGTCC
CCATAATTTTTTAAAATAGTAATGCTATCAATGTTACGTCTATTACCTGTACTGATGTTG
CTTTTTTTGTTTTAGGGAGTGAATCTGTACATTAAGAACCTGGATGACACCATTGACGAT
GAAAAACTACGGAAGGAATTTTCTCCTTTTGGGTCGATCACCAGCGCAAAGGTATCATGG
CAATACCCTTCATTCAACAGAAGCACAAGGGACAGGGGTTTGGGCGGAGGACCAAGCTCC
AGAGATCCATTAGTCCAGAAGGCCTTGTATTTGGCCTTGGAGGTTGTGGTTTGGATCAGG
AAGGGGACTGGGCTTGTGCCTTGTAAATTCAGAGCAGTTTTGGATGGAATAGATACCCTT
TCTGCCATCCACTGGGAATGTTAACTCTGAATGTTTGGAGAGAAAGCAGTCCCTTAAATT
TTCTTCTTTCTGAAGACTTACCTTGATATAAGAGGCGAGGTTTGTGGCGGGGCGTTCAAA
GCCGGGCCGTGTTCTAGAGCCGGGATAAAGACCGCACCTGAATCTTTCCCATGCCTTGCT
GGGCAGTGTGGGTTTGGGGACAGATGGTGCTACACTAGCTGCAGAGGAAATCCAGGCAGG
TTACTTTCCATTTACATTGCAACTTGCCTCTACAACTCTGCCACATTTGCTCTTCTGTTT
TTGTAGTTGTGTGTTTGTGGTATTTATCTGAAAGCCATTTTTTGTTTTTATTTCTTATTA
AAGACCCCCTGCCTTTTTTTTTATGGTATTGAGTGCTTACTATGTGCCAAGCACTGGGGT
AGGTACAAGGTCTCAGTCCCTGTCCCACACGGGGCTCGCAGTCTTTATTACCCATTTTAC
AGATGAGGTAACTGAAGCCCTGAGAAGTTAAGTTGCTTGCCCATGGTCACACAGACAAGT
CGTGGAGCGGGATTATAAAACCCAGGCCCATGCCGTATCCACTAGGCCACACTGCTTCTC
ATTTCCAAGACCACTTCTCTAGAGGGAAGTTCATTTTATCTATTTCTGATGACTGTTTGC
ACCGAACCTCGGCAGAACATTATACCGAGCACTGGGCTGAGGCATAAAAGTTCTGACTAC
TGACCCTGTCCCCCCAGGGCAGCTTCAGCTCTAAAAATGAAGTGAGAAGAGACCTGTGAA
AGAAAGAGCTGGGCAAATTTGGTTTTAAAACAAAAATTTCAAAAAGAAAAAGGAGAAAAG
CCTCCTTCTGCAATCTGGCTCACCTCTTTGGGTCAGGCTCCCTGGCAACAGTGGCAGGAG
GGTAGGTAAGTCAATCAGTTGTATTTCTTGAGTGCTTACTGTGCGGGGCACTGTAATGAG
CCCTTGGGAGAGTACGGTATAACAATAAGCAGACACATTCCCTGACCATAAAGAGTTTAC
AGTGTAGAGAGGGGGACAGACGTTAATAGAAAGAGAGAAATGACAGAAACGGGCATAAGT
GCTGTGGGATTGGGAAGGGGAGATGAATAAAGGGAGCAAGTCAGGACGATGCAGAAGGGA
GTGGGAGAAGAGGAAAGGGGCTTAGTTAGGGAAGGCCTCATGGAGAAGATAGGGCTTCAA
TAAGGCTTTGAAGCAGGGGAGAGTCATTGTCAAATTTGAGGAGGGAAGGCATTCCATTTA
CACTCACTCCCTTTTGTGTATCCTCTCACACACACCGCTTTGACTACCATCTCTAACACA
GAGAGAGAGCAGATCTACATCTCCGCCCCGTCCTCTCCCCCTCCCTTCAGGCTCGCATCT
CCTCCCGCCTCCGGGACGTCTCCACCTGGATGTCGGCCCGCCCCCTAANNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTTCCTCCTCTCTCGCCC
CGCTCCGGTCTATTCTTCACTCCGCTGCCCGGCTCATCTTCCCGCAGAAATGATCTGGGC
ATGTCACTTCCCTTCTTAAACAACTCCAGTGGTTGCCTATTGACCTCCGCTCCAAACAAA
AACTCCTCACTCTAGGCTTCGAGGCTCTCCATCACCTTGCCCCTTCCTACCTCTCCTCCC
TTCTCTCTTTCTACCGCCCACCCCGCACGCTCCGCTCCTCCGCCGCCCACCTCCTCGCCG
TCCCTCGGTCTCGCCCATCCCGCCGTCGACCCCCGGGTCACGTCCTCCCGCGGTCCCGGA
ACGCCCTCCCTCCTCACCTCCGCCAAACCGATTCTCTTTCCCTCTTCAAAACCTTACTTA
AAAATCACCTCCTCCAAGAGGCGTTCCCAGACTGAGCTCCTCTTCCCCCTCTACTCCCTC
TGCCATCCCCCCTTTACCTCTCCGCAGCTAAAGCCTCATTTTCCCCTTTTCCCTCTGCTC
CTCCACCTCTCCCTTCCCATCCCCACAGCACTGTACTTGTCCGCTCAACTGTATATATTT
TCGTTACCCTATTTTGTTAATGAATTGTACATCGCCTTGATTCTATTTAGTTGCCATTGT
TTTTACGAGATGTTCTTCCCCTTGACGCTGTTTAGTGCCATTGTTCTTAGACCGTAAGCC
CGTCAAACGGCAGGGACTGTCTCTATCTGTTGCCGACTTGTTCATCCCAAGCGCTTAGTA
CAGTGCTCTGCACATAGTAAGCGCTCAATAAATACTATTGAATGAATGAATGAATCATTC
CAGGCCAGAGACAAGGCGTGAGCGAGGGGTTGGCAGTGAGATAGGCGAGATGAAGGTATG
GTGAGGAGGTTGGCATCAGAGGAGCCAAGAGTGCGAGCTGGGTGGTAGTCGGAGAGAAGA
TGGGGGAGGCTGTATGGTAACAAATCTAATTATTGCTGAATTGTACTTTCCAAGCACTTA
GGACAGTGCTCTGCACACAGTAAGCACTCAATAAATCTGTTTGAATGAATGAGTCAATCT
GTCAGTGGCCGGGAACCCCAGGCCTTAATGGTGACTGTCCCAGGGGTGGGACTAGCCCAG
GATTCTTTCATTTCTTCTCTAAGCAATGTGGGCTAATGGAAAGATCATGGAACTGGGAGT
CAGGAGACCTGGCTCGGAGTGCTGGTTCCGCCACTTACCTACAGCATGACCTTGGACAAG
TTACTTTACTTTGGTGCCTCAGTTTTCACATCTGTAAAATGGGAATAAAATACCTGTCGA
TGTTATCTGTTGAGGACTTACTGGGTGCAGAGCATTGTATTAAGGGCTTGGGAGAGGTCA
GTACAATGATTGGTTGCGGCGTTCTCTGCCCCCGCCGAGCTATCCTTCCTCCCTCTTTGA
CTGAGTCCCATGTGAGACGGGATTGTGACCGACCTGATGAGCTCCTTTCTACCCAGTGCT
TAGCACAGGATGCTGTGCACGTAGTTTGTGCGGAATAGACTAAGTTCGCTGTGGATGGGG
AAAGTGTCTGTTTATTGTTTTATTGTACTCTCCCAAGCACTTAGTACAGTGCTCCATCCA
TAGTAAGTGCTCAGTAAATACGACTGAATGAAATACTATCACTTTTTATGAAAAAGGTTG
AGCATGAGCCAAACGTGCCCATTCGACACCGGATGTTCCTTGTTGTAGGTGATGCTCGAG
GAGGGACGGAGCAAAGGCTTTGGCTTCGTCTGTTTCTCCTCCCCCGAGGAGGCCACCAAG
GCGGTGACGGAGATGAACGGACGGATTGTGGGCTCTAAGCCGTTGTACGTGGCCCTGGCC
CAGCGGAAGGAGGAGCGGAAGGCCCACCTGACCAATCAGTACATGCAGCGCATCGCCGGA
ATGCGGGCCCTCCCTGCCAATACCATCATCAACCAGTTCCAGCCGGCCGCCGGGGGCTAC
TTCATGCCCGCTGTTCCGCAGGTGAAGCCTGGTTGCCCACCCCCAGGGAATTCCCAGGTC
CCTGCCCAAAATCCTAGCAAATTTTAGCGAAAGGGTGTGAACCCCATTTAAAGTAGAACC
AGACTCCAGTGAGCAGTCTGTGTCTGTAAGAGGGGGAAATGGATGTGGAATTAGTACCAG
GGTCACCTAGCTACCTTTTATGGGACACATCATAATAATTGTAATAATAATTATGGTACT
TGTTAAACTCTTACTATGTGCCAAGCAATGTTCTAAGCACTAAAAGAGATACAAGTTAAT
CAGGTTGGACATAGTCCCTGTCCCACATGGGGCTCACACTCTTAATCCCCACTTTTCAGA
TGAGGTAACAGGTCCAGAGAAGTGAAGCGTCTTGCCCCAGGTCACACAGAAGACATGTGG
AGCAGCCAGGATTAGAACCCAGGTCCTTCTGACTCCAAGGCCCCTGTTCTATCCACTAAG
CCATATTGCTCCTCTGGGTAAAATGGATATTAATGGGCATATGGGGGCATGGACTGCGTC
CAACCAGATTAGCTTGTGTCTGCCCCCAAGCTTAGGACAGTGCTTGGCACACAATAATCG
CTTGTCAAATAATATTAAAAAAAATTACGGCTTTGGGTTGGTGGAAGACTTTGCAACAGT
TGCTTAGGAACTGACCTTAAGTGACCACATTTTCTCTGTTCTCCATTTAGGCTCAGAGTA
GACCCACCTACTATGCACCCAATCAGATGGCTCAGATGAGACCCAACCCTCGCTGGCAAC
AAGCAGGGAGGCTGCAAGGTAAGCAGGGAAGGGACGGGAACGGAAAAAAAGGATTCACTC
CAAACATCCTGTTGCCCTCATGAGTGAAGCAGCGTGATGTAGTGGAAAGAGTCCGGGCCT
GGGAGTCAGAGAACCTGGACTCTAATCCCGGCTCTGCCACCTGCCTGTTGTGTGACCTTG
GGAATGTCACTTCACTTTTCTGTGCCTCAGTTTCCTCAACTGCTAAATGGGGATCTGACA
CCGGGCCTCCCTCGTATTTAGACTGCGAGCCCCGTGTGGGATGGGGACTCAGCTGATTAA
CTTGTATCTACTCCAGTGCTTAGAATCATGTTCAACATGTAGTAAGGGCTTAAATGGCAT
GATTATAGATGCAGAACAGTAGGATGAGGTGGGTCAGTGGTCTTGTGTATGTCCTGAAAT
ACCATGCCCACCCCCCCGGTCTGGTATGAAAGGTAGTCTAGGCAGGTTTTTGAGCCAAGA
AGACCAGAGGGAGTTCCTCTGGGCATCAGTCTGCCCTGTCAAAAATCAGTCTCAGGTGAA
CTTATTGCTGTTTCCCAAAAATAGGAAATGGGCATGGACCACTGCAGACGGTCTGTCTGG
ATTTAGTTTTTAGGTTATCCCTTCGGGTAAACTGTTCATTGTGAATTTATCATTAGCCAT
TTTGCCCTTGACCATGTTAACATCTGCCTTTCCGAAAACCAGTCCATACCAGTTGCCCGT
TTTGTGACCGGGCAGTGAATGGAATCTATGAAAAAGCCATTGGGTTTCTTTTGCCTGCTT
CATCAATCTTTTCTGGCACCTCAACTTCTCTCCCACCACTGGCTGCAATGGCAAAACTGA
GACCTCCTTCACGACTCATGCTTCTGCCTCGATCTCCCCCCCCCCCGCAGGCTTCCAAGG
AATGCCAAATGCCATGCGCCAGTCTGGGCCTCGCCCAGCCCTGCGCCACCTGACCCCAGC
GGGTAACGCTCAGGCCTCTCGCGGCCTCCCGGCTGCTCCCCAGAGAGTTGGTAAGTGGCG
TCCTTCTGGGAAGTGACATTTTTCTCCCCAAAGAGGAATTTGCGAAGGATTGAAGCCAGG
GCGGGATCTTCTTCTCACTGTCCCGCTGGCGGCTGGTCGGGCTCGAAGCCGGCTGGGGTA
CAATTGCGTTGGATTGTTTCCGCCCTCTACCGTGACGTGAGAGTCTGAGGATGGGAGATG
TTACAGAACCAGCAGGGGAAATCCAGATGGGTGATCTTCCACCAGAGATAGAGATAGCCC
TCATCTCTACACCTCTGCCATAACTCTTGGGTCCTGAGAGTTTAAGGGGCACAGCGCAAT
ATATTACACTTTTCAGTTCCGCTGCAGTCAGGCCATTTGGCTGTGAGTCGGATAAACTCT
CCCCCTTATGGGGGAGTAGTGCTACTTGTTGTCTGATCAGCTGGGCATCTCTTCACCTGG
AGAGCTGAGTTGGAGTGCAGATGACCTGGGTTCTAATCCTGCCCCCCCCACCTCGGCTTT
GTGACCTTGGTCAAGTCACTTCACTTTCCTGCCCCCTTTTCCTCTTCTGTAAAATAGGGA
TAAACGGGTGAGCCCCATGTGGGACAGGGGGACCGTGTCCATACTGATTAACTTGTATCT
ATCCCAGCACTTAACTAGTACCGTTATTATCGTCATCATCAAATGAGGTGCACCGGCACT
GGCTTCCCGCAGGGCTCGCAGAAGCTCCCGTCTGTTTCTCTTTCCAGGGGTTCCTCCTGC
CGCGCAGAATTTAGCTCCCCGCGCCCCCGTGGCGGCAGCTACCCCCCGGGCTGTCCCTCC
TTACAAATACGCCTCAAATGTTCGCAGCCCCCACCCAGCCATTCAGCCTTTACAGGTAGG
TAATGAAAGCGACTGGACGCGTGCCAGCCGAGGTCGGCTTGACCTGCGCGGTGGCTACGG
GAATTTCCGCAGAAGTTGCCAAGTTATCCCTTTAGTGGTTGGAAATTAGGGCCCTTCTCA
TTGTGGGGTGGTTGGGTGTAGCCCATATTTCGCTCCTGAACGCCTGTAACCCTTTCTGTT
CTTTCCCTCCCCACTCTGTGTTCACCAACAGGCCCCTCAGCCTGCCGTGCACGTGCAAGG
ACAGGAGCCTCTTACAGCTTCCATGCTGGCAGCCGCTCCGCCTCAGGAGCAGAAACAGAT
GTTGGGTAAGTGAGAAACCTTTGGACCCGAAGTCAAAGATTAGTACAGTCCTGGCACGGG
ACATCCTTTCTCAATGGGCAGCTCATTCAAGTCGGGCACTAAATTTCCGTTGAACAATGC
CTGGGATCCCACCTTAAAGAAGCCATTTGGTAGTTGAATTATAAGAAATTGTGCTACTCA
AGCATTTTACTGTGTGCCCAGCACTGAGGTAGATGGAAGATAATCATATCCGACACAGCC
TCTGACCTTCTCTCTCCTCTTAGGCCCGCCCAACACGCACACACAGGATTCCCGGTCTCT
GAATCCCCATTTTCCCCTAGACAGAGGGAAATGAAGTGATTCGGCCAAGGTGTCACAGCA
GGCGAGCGGCAGAGTTGGGATTAGAGCCCAAGTCTCCCAATTCCCAGCACTGAGCCCTTT
CCACGATGCCACACTGCTTCCTTCCCAGCTGGTGGCAAAATGCCTACGGAGTTGGCTTCT
TAAAGTGACCTCTGCTGTGAACATCCTTGCAGGAGAACGCTTGTTCCCACTGATCCAAGC
TATGCACCCCAGCCTGGCGGGAAAGATCACAGGGATGTTGCTGGAGATCGACAATTCCGA
GCTGTTGCACATGCTGGAGTCGCCTGAGTCCCTCCGCTCGAAGGTCAGCCCGGCTCCCGT
CACTGCCCGCCTTGGGTCGGCCTGGAGGGTGACTGGGGGGTGGGAGGTGGGGCGGGGGGC
AGTCACTTAATCCCGAACAACCTTCCGCAGGTGGAGGAGGCCGTGGCAGTACTACAGGCT
CACCAAGCCAAGAAGGAAGCAGCCCAGAAAGTGGGCGTGGTTGCTGCTACCTCTTAGATG
GGGAAGGCTGGTAGATATACTCTCGAAACCGCATTTGTTGAAATGACAGACCTAAATTGA
GGAAAACTGTAAAGTACTTGTCATTGTCTGGGCGCCTTTTGAATTTGTCTAGGGTGCTTC
CATAATAATTACGGTACTTGCTCAGCGTTGATTTTGTGCCCAGCCCTGTTCTAAGCGCTA
GGGTAGGTAAAGTTTAATCAGGTTGGACACAGTCCCTGTCCCACGTGGGGCTCACACTCT
TAATCCCCATCTTTCAGATGAGATAACTGAGACCCAGAGAAGGGAAGTGACCTGCTCGAG
GTCCCACAGCAGACAAGTGGGGGATCCGGAATTAGAACTCAGGTCCTTCTGACTCCCAGG
GCCCGTGCTCTATCCAGTAGGCAGAGCTGACGGTAACAAATAAAAAGCAAAATGTCCGGA
CAGGGAGCATCCTGTACAGACACAGACCCTAGGCCCCTCCTGATAGAAAACATTGTTTAT
AAGTTGGGCTATTTCCAGATGTTCTAGTCTAGAGGAGTTTCTTCCCAAATTGGGCTACAA
AGCAGGTCTCGGTTTACCGGTCAGTGAGATGGGTGGCTGTTACCTAGTTTTCAGAGATGT
TAAGGGATTACCGAGGGGGCTTGGTGGGAAAATAGCTCTAAAGTGCCCTGAACATTTAGA
CAAAAGGTGTCCTATGAACATGAAGTGTTTATTGGTTGTCTCGTTATCTTTGCAGGACAT
GAAGAAGCCGAATACCCCCTTCGTAGATATTAGCTTAAGATGTGTGGAGATGTCTTCACT
GTCCCGTAGATCCGAATGCCAAGAAATATGTCACCGAAGTTTTTTGCCATTTTTGTAAAC
TTTCTTTGAAAAGCCATTTCAGAAAGTCAGCTTGTGGAAAAGGTCTGGGCTTTCAGGATC
CAAGCTTTTTGTCTGCAGCCGGGGCAGTGCCGACACCTTCCTCTTTTCTAAACAGAAGGA
ACTTTTCTGACTGAAAGTATTTTTGGGGATTTCGGTTTTATCAGGAGTTGGTTTTATTTG
GACTCTCCAGTTTGTGAAGTCTCGTAAAGTTTCTCAATAAAGAAATAAAAACCTTCATTA
AATTGCTTGTGTATTTTTATCCCTGCATCGTGCAGGCTCTGCTGAATTTATTTTATTTCC
ATCAAAAGGAAGTCTTAATTTTCACAGGAAGGAGTCTTTGGAATGGAGTAAATCAGTAAA
ACTGTCGATTTATTCCCTCATTCACTTTAATCTTGTCTTCAATGTCCTAGGCCAACCGTT
TAGAACAATGTGCAGCCCAGAGTTAACGCTCATTTGAAAAGGTTTAGTGCTCTCATTTGA
ATGGTGTCAGCTACCTGAAAATGCCACATTAAACATGGCGGACTGTGAAGCAGAAAGTTC
TAAATAATGCTGAGCAGTGGTCGTTAATTTTGCCTCAACCCTTACGCCCTTCACGGCATT
TTTTCAACTTCACAAAAACGGAACCTGGACGGGAGGATACAAAAGAAAATTCATGGTGCA
GGTGGGAAAGGATTTGGTTTAGTAGGAGTCATTGCATGTCTGGGATGCTTAGGGGTGTGT
GTTAAGCACTCACTGCAGGGTACTAAACAGGAGATAACAGTCCCTCCACACATGGGACTC
TGTATAGGAGGATAGGACAGGTATTAAATCTCCATTCTATTGATGAGATAAGCACAGAGA
AGTTAAGTGACTTGCCCTAGGTCCCACACAATCTTTGGAGGAGCCAAGGTAGAGGACCAT
GCTCTTTCTGCAGGGCCAGGCTGTTTCTCAAGGCGCTGTGTGTTCCAAAGAGGAGAGAAA
TCCTGAAACAGTATGTCCAGGGATACTTAAAGAAAACATGGAGGGTGCAGTTTCATTAGA
TTATTCTTCACAAATGTGGATGGAAACAAGTTGCTTAAACAATCTCACATATTGACAGTG
GCTGGATTGAGGCATCACCTCCAAGGGGCCTTCCCTGATTAAGCCCTCTTTTCCCGGGCT
CAATCTCCCTTCTGCGTTGCCTCTGCACTTAAGCTTATGTACATATCTTTAACATATATT
ATGAATTATTATATTAATGTCTGCCTCCCTTCTAGAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1193, 4469..4662, 5414..5529, 6954..7093, 7608..7702, 8417..8554, 9915..10010, 13968..14240, 14930..15017, 15890..16009, 16727..16854, 17071..17164, 17672..17802, 17910..18009, 18715..19076
1001..1193, 4469..4662, 5414..5529, 6954..7093, 7608..7702, 8417..8554, 9915..10010, 13968..14240, 14930..15017, 15890..16009, 16727..16854, 17071..17164, 17672..17802, 17910..17996
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved