Ornithorhynchus_anatinus Locus Mono:SCARNA1
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SCARNA1
Ornithorhynchus_anatinus
Mono:SCARNA1
Contig66411
SCARNA1
1001..1164
1434
TGAGTGGACATATTCCCTTCCCATAATGAGCTTACAGTCTAGAAAGGCTTTCTGGTAAT
GACTGGCTCTCTGCTTACCAGCCCTCTCCCATCAAAGCCTACAATGGACAGGGACTGGGC
GACCAGTCAGTCAGTCAGTTAATCGTATTATTGAGAGCGTACTGTGTGCAGAGCACTGTA
CTAAGCACTTGGTAGAGGAAAATATACAATAAACAGATGCATTCCCTGACCACAACAATC
TTACAGTCTAGAGGGGAAGGAGAGTGCCACCCAAAAATACCTCACAGCTTTTACCAGCCC
CCACTCGTGGCGACCTGAACAGTAATAACGGTGGTGTTTATTCAGCACCGAGCCCTGTGC
TAAGCTCTGGGGTCTCAGGAGAGCAGCAGACTGGCCATTGATGGGGAACCAGTGCAGGCT
GAGTGGGGCTTGACAGGAGTTGGAGCCAGCGGACTGAGGATGGAGGGTCCAGGTTGAAGT
GAGGCCCAGCGTATTTGGGGGACAATGACCGCCCCCTACAAGACTGAAAGTTTATGGGCA
GCGAACGTGTCTGCTAATCCTGTTGTATTATACAGTGCTTAGTACAGTGTTCTGAGCACA
GTACCCACTCGATAAATATAATTGAATGAGTGAATAATTCTGTTGTACTCTCCCAAGCGC
TTAGTACAATGCTCTGCACGTCCTAAGCACTCAGTAAATGCCACTGATTGATTGAATTGT
GCTGAAAGAAGGAGAAGCCTGAGCAGCTAGAATTGGGCCCCTCTGGGGTTAGGGGCAGGA
GAGCTGACTCCAGGAGTCGGACTCAGCAGTATTATTAACCCCTCCGCACTGTCTCTCTGC
ATCTGTTCTGCTGAACTTGGAGGCCCGAGGGAGTCTGACTCCCGGGACAGTCGGGGGTTT
CGCTCCCTGGGGCTTCTGGGCTTTGCCTGTGTCCGGGAGGAAGAAGAGATGGGGGAGGAG
GAGGAGGAGACCTGGGCTGCCCTGGCGACTTAGGAGGCGGCACGCACTCGATACTAACCG
AGCCATCTGGCCCTGGCCTCCCTGCGGGGCTCCTGGGGCTGCCTTGTGGTGGCTGGGTCT
GAGCAGTGCAAAATTAGCCAAGCCGTGAGGACTCTGAGCTCAGCGTGGGGAGACACACTC
TGGGTTATAACTCAAAGGCACAGCCGGGCAGGGCCTGGTCACAGGGGGCCCCGAACCGCT
TCTCAGCATTTGTAGCTTTTGGGGAGCATCAAGTCCCCAACGTGGTGTGCTCCTAAAGCC
CCCCTAGCGTCCCGGTTGGGTTGCCCGGGGCAAGGCCCGAAAGATGACCCGGGGCAAGGC
CCATGGTCCCTGTGCTTAATGTTGGCCTTGGGAGGAGGCTCAGTGTCCCCGAGCTGGATT
TTGGTCGCTTCCAATCTATCGTTAGACCATGGGCTAGGGCCAGGGCTGACTCTTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved