Ornithorhynchus_anatinus Locus Mono:SNORA44
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SNORA44
Ornithorhynchus_anatinus
Mono:SNORA44
Contig65777
SNORA44
152..285
1285
ACTGTCTCTATCTGTTGCCGATTTGTCCATTCCAAGCGCTTAGTACAGTGCTCTGCACA
TAGTAAGCGCTCAATAAATACTATTGAATGAATGAATAGAAGCGAGTCGGGCCGGAATCG
GGTCTGGATGGGCGGCGGTAGGTGGGCTCCCTCGGCATGTTCTTCAAGGGCCGAGGCTGG
ACGCAGTAGCCTCGGCGTCTCCAACTGCATGCCACAACAGCCTGGAGAGACTTTGACAGC
GCAGAGCCTGCCGTGCCTGGTGCTGCCACTCGGCTCTCCCACAGTTGCCCGCGGGCCGCA
AACCTTCTCCCGGATTTGCCCCCGGACCCCCCTCCCCAACGCCCCCTGACCCGCCTCTCC
TGACCTAGGGCCAACGCGCCGGAGCCCGGCTAGCGCCGATGGGGCCTGACCACAGACCCA
ACTTGTCAAGGAAAAGAGTGCAGACTTTGCCACCAGCCACCGGCACAGGTGAGAGGCGAA
TGGCCGTTGCCCCCTACCCATCCCTCTGGATCCCTTTCCCATCAGGTCTGCACACCGACC
TGGGTGGTCGTAAATGGAGGGAAAGGAACTGGATGCGGGCCCGAGTGTCCGGTGTGGAGA
CAGCGGACCAGGCCCGGTCCTCACAATCACCTGAGAGCCTTTGTCCGGTAGTGGGAGGGC
CTCAGAGCTGCTTCCTAATTTGCGTTCCCATCCTGACAGAGGCCTGAGCGTTGGCAGTGG
AGGCACCAGACCCGGCTGCTGCTGTTGGCGGTAGCCATGTGCTGGGTAAGTCGGCTGGCA
GCAGTGCCGCAAGGGGCAGGACCTTGGGAAGGCCTTCCCCATGACAGTGGGGCAGGGGTG
GGGCTGTTTCAGTACAGCCCTTGGGATGGGATGGACACTACTCTGGTCTTGCTGGTTAAC
GATGACACTCAATGTGGACATGTATGGATGACACTTGCCGGATATTGGNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved