Ornithorhynchus_anatinus Locus Mono:SNORA61
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SNORA61
Ornithorhynchus_anatinus
Mono:SNORA61
Contig65777
SNORA61
500..627
1627
ACTGTCTCTATCTGTTGCCGATTTGTCCATTCCAAGCGCTTAGTACAGTGCTCTGCACA
TAGTAAGCGCTCAATAAATACTATTGAATGAATGAATAGAAGCGAGTCGGGCCGGAATCG
GGTCTGGATGGGCGGCGGTAGGTGGGCTCCCTCGGCATGTTCTTCAAGGGCCGAGGCTGG
ACGCAGTAGCCTCGGCGTCTCCAACTGCATGCCACAACAGCCTGGAGAGACTTTGACAGC
GCAGAGCCTGCCGTGCCTGGTGCTGCCACTCGGCTCTCCCACAGTTGCCCGCGGGCCGCA
AACCTTCTCCCGGATTTGCCCCCGGACCCCCCTCCCCAACGCCCCCTGACCCGCCTCTCC
TGACCTAGGGCCAACGCGCCGGAGCCCGGCTAGCGCCGATGGGGCCTGACCACAGACCCA
ACTTGTCAAGGAAAAGAGTGCAGACTTTGCCACCAGCCACCGGCACAGGTGAGAGGCGAA
TGGCCGTTGCCCCCTACCCATCCCTCTGGATCCCTTTCCCATCAGGTCTGCACACCGACC
TGGGTGGTCGTAAATGGAGGGAAAGGAACTGGATGCGGGCCCGAGTGTCCGGTGTGGAGA
CAGCGGACCAGGCCCGGTCCTCACAATCACCTGAGAGCCTTTGTCCGGTAGTGGGAGGGC
CTCAGAGCTGCTTCCTAATTTGCGTTCCCATCCTGACAGAGGCCTGAGCGTTGGCAGTGG
AGGCACCAGACCCGGCTGCTGCTGTTGGCGGTAGCCATGTGCTGGGTAAGTCGGCTGGCA
GCAGTGCCGCAAGGGGCAGGACCTTGGGAAGGCCTTCCCCATGACAGTGGGGCAGGGGTG
GGGCTGTTTCAGTACAGCCCTTGGGATGGGATGGACACTACTCTGGTCTTGCTGGTTAAC
GATGACACTCAATGTGGACATGTATGGATGACACTTGCCGGATATTGGNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved