Ornithorhynchus_anatinus Locus Mono:SNORA7
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SNORA7
Ornithorhynchus_anatinus
Mono:SNORA7
Contig63387
SNORA7
195..333
1333
GAATAAAGAAAATCGGCTTTGGACTGAGAGCTCATGTGGGTAGGAACATATCTACTATA
TTGTACTCTCCCAGGCACTTAGTACAGTGATCTGCACCCATTAAGTGCTCAAATAAATAC
CATTGATTGACTGATAGCAGAATTTCATGTTATCATTCACCTACTGGAGATTATTGGCTG
TGTACAGGACTTGCCCCTCTCTCAGGGTGGTACCTGGAGAGTTTCCAGGCCTCTACCAGT
TTTGGCTATGGGAGGGAGAATCAGGCAGAGGCATGCCTATTCCATTCACTAGCTTGGGCA
GCAGCTAGCGAGTGGAAGGCCATCTGCTACAAATCAAAACTCACCTGTGCTGGGCAGCAG
CGGCATGGGAGAGAGTCAAGGATGGAGACTCGAGTTTACTGAGCTGAAGGCAGCAATGGT
AAACCACTTCCGTATTTTTACCAAGAAAGCCCTATGGACACATGACCAGAATGATTGCAG
ATGGAGAGTGGGGTGTTCTGGGGGAGGTGTGTCCATGGTGTCGCTATGTCTCTGAAATGA
CTCAACGGCATAAGACAAAACATAGGACTCTTCAGCTATAGTCGGCAACAACACCTCAGG
CTGATTGTTAAATCAAAGTAGTATATTAATTTTGAAAAGTACTTTGTAGTCATCTCCAAA
GTGCTTGCAAAGGTGTTTCTTGCACACAATCTTGTAGCAACTTCTGAATTATTGATTCAA
GCCTTTCTTTGATGTTCTTAGCCTGAAGAGTTCATTCATTCATTCAATCATATTTATTGA
GCGCTTATTGTGTGCAGAGCACTGTACTAAGCACTTGGAAAGTACAATTCGGCAGCAGAT
AGAGGGCAATCCCTACCCAACAACGGGCTTACAGTCTAGAAGGGGGAGACAGACAACAGA
ATAAAACAAGTAGACAGGCAAGTTCTCCACAGTTCTGTCTTACTGTTCAATGATTCCTTC
AACTCTGGGTACATAGGAGAGACCGTGAGCATGGCCAAGAGGAAAGACTACAAGATTGGG
AGTCAAGAGATCTGGGTTCTAATCCCATTTCTCCCACTTAAATGCTGAATAACCTTGGAA
AAATCAATTAACTTCTCTGTGCCCCAGTTTCCTCAACTATAAAATTCAATTCAATTGTGT
GTTTTCCCTCCCTCTTAGACTGTGAGCCCCATGTGTGGCAGAGACTGTTTCTACCTATTG
CATCTACCTTTGCCCCAGGATTTAGCACAGTGATTGACACAAAGTATGTGGATGACAATT
ATTATTATTATTCTTATCGTCATCTTTATTATCATTATTACAGATTGAAAATAGACTAGA
CCTGGTAAATACTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved