Ornithorhynchus_anatinus Locus Mono:SNORA7
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SNORA7
Ornithorhynchus_anatinus
Mono:SNORA7
Contig63162
SNORA7
124..261
1261
CCAGTCACTTCACTTTTTCTGGGCGTCAGTTCCGTCATCTGAAAAATGAGGATCAAGAC
TATGAATCCTTTGTGGGACAGGGACTGTGTCCAATCTGATTAGTTTGTATCTACCCGAGT
GCTTCCTCTCTCAGAATCGCATCTGGAGAGCTTTCAGTGCTCTACCAGTGTCAGTTATGG
GAGGGAGAGTCAAACAGAGGCATTCCCATTCCATTCTTAGCTTGGGCAGTGGCTAGCGAG
TGGAAGGCAATCTGCTACAAGTCAAAACTCATCTATACTGGGCAGCAGCAGCATGGGAGA
GAGTTGAGAAAGGAGACTTACATTTACTGTAAAGAATGAGGCAATGAAAGTTACTTTTGT
ATTTTTACCAAGAAAACGCTCTGGATACACTACTAACATAATTGTAGATGAAGGAAGGGC
ATTCTGGGAGAAAAGTATCCTTGGAGTGTCTATGGATTGGAAATGACTCAACAACATAAG
ACAAGATCCCAGTACTTAGAACAGTGTTTGACACATAGCACTTAACAAATACTATTATCA
TTATTATCAATAATAATAAGTACTTAATGATTACATTGTACTGTAAAAGGCATTTTGGAA
GTGGTACCGAACAGTGATGTACATTGCAAGTAAAGTGATTCCCTTTCAAAAGAAATGGTT
GTTATCAAAATCCTGAAAAAACAAAAGATAAAAGTCTGTCTGATATATATGCATATATAT
TTATATATTTTTTTTTCTATAAGGTCTCTTTTTACCTCATGTCACATGTAGGACTCATGT
CCAGCCCTCTCTCCTCTCCTCCAGTGCTATTAATACTAATACTAATGTGCATAAACTGCA
TAAGATTGGAATGAGTTGTTAAAAAACAAACTATTCCACTTTATTAGATTTCAAATATAT
TTTCAAGACGATTAAAAGTTCCACATGCATCAGATCATGTTTTCATTGTAAGAATATATG
TGGATACCTCTTTTAATATTTTAATATATTTATTTTATTAGAACATTCATTGAACTAAAA
TATCTTTATTATACCATATAGACATATATGAAAATGCTAAGGATGGATATCAATAAATTC
ATAAAGTCTAGAGAGGACTAATGGGTTTATATGACAATGGGTCCTGGGACCTAAACAAGG
AAGACTTGTTGGAGGAAGTGGAATTTTGAGAAAACTTTCAATGTGCTCAGTGTTGTGGTC
TGTAATATTTGGGGAGGGAGAAAATTTAAAGCTTTGAGAATAGCATGAGTGAAGGAAGAG
AA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved