Ornithorhynchus_anatinus Locus Mono:SNORA7
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SNORA7
Ornithorhynchus_anatinus
Mono:SNORA7
Contig61195
SNORA7
81..218
1218
TTAGAAACAAAAAGGGCTGCACAAGGTTGTCAAGGATCAACTGTGACTTCCTGTAGTTA
GGATGGGTGAAAGACTATGCCCCCTATCAGGGGTCACACCTGGAGAGTTTCCATTACTCT
ACCAGTCTCAGCTATGGGAGGGAGAGTCAAGCAGAGGCCTACCCATTCCATTCCTAGTTT
GGGCAGTGGCTAACAAGTAGAAGTCCATCTGCTACAAGTCAAAACTCCCCTGTGCTGGGC
AACAGAGGTATGGGAGAGAGTCAAGGAAGGAGACTCGAATTTACTGAGCTGAAGGGGGCA
ATGGTAAACCACTTCTACATTTTCACCAAGAAAATTCTATGGACACACTACCAGAACAAT
TGCAGATGGAGAGCGGGGCGTTCTGGGAGAGAGAAGCAGCGTGGCGCAGTGGCAAGAGCA
TGGGCTTTGGAGTCAGGGCTCATGAGTTCAAATCCCAGCTCTGCCACTTGTCAGCTGTGT
GACTGTGGGCAAGTCACTTAACTTCTCTGTGCCTCAGTTCCCTCATCTGTAAAATGGGGA
TGAAGACTGTGAGCCCCACGTGGGACAACCTGATTCCCCTGTGTTTACCCCAGCGCTTAG
AACAGTGCTCTGCACATAGTAAGCGCTTAACAAATACCAACATTAGATGTGTCTGTGGAG
TCGTTATGGGTCAGAAATGACTCGACGGCATAAGACAGGACAAGAGAGACTATGGATTTA
GAGGAATCAGAAGTTAGAGTCTGTATTGTTAGAGAAGCAGCATGACCTAGAGGAAAGTGC
ATGAGCCAAAAAGTCAGAGGACCTGGGTTCTAATCCTGTCTCCACCATTTAGCTGCTGTG
TGATCTTGAATGAGTCATTTCACTTCTCAGTGCCTCAGTTATCTCATTCTGTAAAATGGA
GATTACCATTTTAAGCCCCACATGGGACATGGATTCTGTCCAACCTCATTAGTTTTTATC
TACCCCAGCCCTTAGAACAGTGCCTGGCACATAATAAGTGCTTAACAAATGCCATAAAAA
AACCAATCCCGGCTCTACCATTTAGGTTCTGAATGACCTTAAGCAAGTCATTTAACTTCC
CTGTACCTCACCTCCTCTGTGAAATGGGGATTAGTCAATTAGTCAATCTTATTTATTGAG
TGCTTACTATTCATTCATTTATTCAACTGTATTTATTGAGTGCTTACTATGTGCAGAGCA
CTATATTAAGAGCCTAGAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved