Ornithorhynchus_anatinus Locus Mono:SCARNA1
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SCARNA1
Ornithorhynchus_anatinus
Mono:SCARNA1
Contig60455
SCARNA1
133..259
1259
GGGATCAGCTCTTTCCTGGAGATCATTGAGGACGAGGTGCGCGTCGGACTCAGTGAGTC
AGTTTTTATGTAGGTCAGACCACTTTGCCCCAGGCGCGTTGTCATGCCAGAAGGATGAGC
TGTCCTGGCGTGGCAGCTATGGAGAACACCTCTCTCCCGGGTGGCTGGGTGGGAGAAGAG
CAATGGGAAAAGAATTCAGGAGGATCTTCAGTTCAGAGTGGAGAGCTGTAAACTTTGGTT
TGTAACACAAAGACACAGCTGGATGGTATCACTAATGCATGGGCCATTGATTTGGGTTGT
TTTGTTCATAAGAAGCCCAGGTGACTTTTCCCTTATTTATGTTTGTGGCCACGTATTTGT
TTCGGGAACCATCAATTCATATCCTGTACTTATTATTACACTTTAATTGCTCCCAACAAA
AGCACTCTGCCTATATTCTCTGGACAGAAAAAGGGTCTCACTCAGAGCTGGCTAGTCCGT
GACTCGCTTTAAGGAAGGTGGTTGAAAAACCTTTTAAAAAGAGAAATATGCCCACTTCTA
GAAGGTCCCTTTGGGTAGGCCAGGTTTGGTACCTGGAAAACATGTGTGGCCTAGAAGAAT
GAGCATGGTACTGGGAATTAGGAGATCTGGGTTCTGGTCCTGGCTCTGCCACTTGGCCTG
CTGTGCAACCTTGAGCAAGTCACTTAACTTCTCTGTGATTCACTTTTCTCACCAGTAAAA
TGGGGCTTTGATTGGGAGTCCCAAGTAGCACGGAGTCTGTGTCCGATCTGATTATCTTGT
ATCTATTCTAGTACTTTAGTACATTGCTTGGCCCGTAGCGCTTAGTAAATATTGCTACCA
CTGTTTATTATTTCACTGCTATTGTTTTTTCAATTTAGAGGTGTCCATTTAAAAGGGCAC
CCTCATTTTTGCCTAACTACAATCAATACAGTCTTTTTTCTTTTTCAACCTTCAGTCAGT
GTTCAGTAACAGAAGTACTACTTCACAGTTTTCATGGGAATGTAAATTTGGGGGGCTGAA
AAACTCAAGTGCTAATGAAATTCAGCTCCCTGGGGCCTGCCTCTATGAGAGATTTTACCA
CAGACAGTGTATATCCGCAGTATTTCCTCTGTATCCTTTCAGTTGCATTGTGAATTTTAG
CTAGTTAAAGGTCATCCATGACTCAGAATCTCCATCGAGAACTTTATCCTTAGGGTTTTA
TGGACCCAAATGCAGTCATGGGGGATTTCTGGGTTCCTCAGGCTGAGGTTCAGCACCAGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved