Ornithorhynchus_anatinus Locus SEC14L3
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus SEC14L3
Ornithorhynchus_anatinus
SEC14L3
Contig6021
SNORA7
10151..10293
19743
TCGGTGGCTGACCGTCCGGCCTGGGGCGGGGGCAGACCCGGAGGGTTTGAGTTTCAGAG
GGGTGAGGAGGCCTTTCCTAGAGAAGGACCAGTTCTGACTCTTTCTGTTTCTGAAGTTTG
GGTCTGGCTGGCCACGAAGCTCCCTGCGACTGGTAGGGCAGCCATCCTCTGAGACTCTGC
CATTTCAGGTAGGCACTGACATACCTGGGAGGGAATTAGAAGGCCTTGGGGACCAAGCTG
GACAACCACGCGGCGGAAAGTTTTCAGCTGGGGGTTACGGTGGTCTCACCCAGCTGGATG
CACTTGCTCCCTCTGAACGGGCCCCATTCCTCCTTCTGCCGCAACATGGGGTGGGAGTGG
GTCTGGCACTCATTTTCAAGTTTCCATAAGGACTCCATCTGGCCCCAAACTTGTCTTCCC
AGCTCTGCCTCTGGTCCAAAGTCTAATGCCTCTTGGAGATCAGATCTCCTCTCTCCCTCC
CCACACACTGCCTGCTAAGGTCCTCAAGTCTCTGCCTCAGTTGGGGAATGTGTGTCATTT
TTTTTAATAGTATTTGTTAAGGTCTTACTATATGCCTCACAGTCTTAATCCCCATTTTAC
TGATGAGTTAACTGAGACCCAGAGAGATGAAGTGACTTGCCCAAGTTCTCACAGCAGACA
AATGGCGGAGCGGGAATTAGAACCCAGATCCTGACTCCCAGGCCCAGTCAGCTCACTGAA
GGCTTCCTTAAGAGGACCATTAATTAATTGGTGCCCTCTCTTCTGGGCAAATAGGAGAGG
AAGCTGCCTCTGTCTTTATGTACCGAGTCCCTCCCTCTTCTTGCCTAGAGTGTACATTTA
ATTACTCTTTCAGTGCCAATTTTTCAATGCCGTGTTTCACTTTTAACAAAGTGCCAGAAG
GTCTTCCCTCACCTCACAGTGCTCCTCTACATGGCCCTGGGTCTCTGTTCCAATATCTTT
CTCTGGGTTTGTGCCAAGGCCACACACGTGATCCCACCGTCTCCAAATTATATAACGTGT
AGTACAAATAAGGAGCCAAACAAGAGGCGGTGTTTGGTCAGGCCCAGTAACCCTGGCAGA
GGGAGCAGGCGGTCCTGAGGTCGTGCAGAGGGACGCCCGGATCCAACTTTCCATCTCCCC
CAGCCTCAAGTAGCTGAGCTCCAGGGCCACCATGAGCGGCAGAGTCGGAGATCTGAGCCC
AGGGCAAGCGGAGACCCTGGCCAAGGTGAGGTAAACTGCTCCCTCCCTTCCGAGCTGCCC
CACCCTCCCAAGTGGTTGGCATCTTCTCCCCCACCCCAACCCGGAGGATGACACCGGGAG
GGATCTCTTGCCTCAGGGCAAGACCTGCCATGGCCTGGTGAATAGAACATGGGCCTGGGA
GTCGGATTATAACAATAATCATAATGATTATGGTATTTGTTAAGAGTTTACTTTGAGCCA
GGCACAGTACTAAGCGCTGGGGTGGATACAAGCAAATTGGGTTGGACACAGACCACGTCC
TGCATAGTCTTAATCCCCATTTTACAGATGAGGTAACTGAGGCACAGAGAAGTGAAGTGA
CTTGCCCAAGGCCACACAGCAGACAGCAGGTGGAGTTGGGATTAGAACCCATGACCTTCT
AACTCTCAGGCCTGGGCTCTGTCCATTATGCCATGCTGTTTCCCTGTTCTATTCTTGGCT
CCTCCACTTGTCTGTTGTGTGATCTTGGGCCAGTTACTAACTTTTCTGTGCCTCAGTTCT
CTCATCTGTAAAATGGGGATTAAGTCTGTGTGGGATGGGATTGTGTCCAACCTGTTAACT
TGTATCTCCCCCAAGTCTTACTACAAGTATCATAAATAAAGGTGCTTTTGACCAATTTCC
CTGCCCCTCCCTTTCCTCAAACAACGCTTGGTCTATCCTGTCAATTTTAGGTCCTTTGAC
CTCCGGTCTCCCCTCTAGATTATAAAGTCATTGTCGGCAGGGAACACGTCTACCAATTCT
TCTGTATTTTATTCTCCCAAGCGCATACTACAGTGTTCTGCGCTCAGTAAGCGTTCAATA
AATACCATTAATGGATTGATTGGTTGGTTGATCTGGAATGATTCACTTTCCCTCTCAGAA
AAGTGGGTTCACGGCTTTAGGAAAGTGATAACATCACCATTCCCTGTTGCTCTAGTCTGT
AACATGCATAACTGCCAAGTCTCTAGCTTCCAGCTCACAATCATATCATCAGCCTCTGTT
TTTTTATGGTATTTGTTAAGTGCTTACTATGTGCCAGGCACTGTACTAAACTCTGCACAC
AGTAAGCGCTCAATAAATATGATTGAATGAATGAATGAATGGGGAAGATAGAAGCTAATT
CATTCATTCATTTAGTAGAATTTACTGAGCGGCTTACTATGTGCAGAGCACTGTACTAAG
CGCTTGGAATGTACAATTCGGCAACAGATAGAGACAATCCCTGCCCAATGATGGGCTTAT
AGTGTAATCAGGTTGGACAGAGTTCCTGTCCCACGGGGGGCTCACAGTCTTAATCCTCAT
TTTACAGATGAAGTAACCGAGGCACTGAGAAGTGAAGTGGTCTGCCCAAGGTTACACAGC
AGACGAGTATCTCCTCTTCCCATTTGCAGTGCAGTTGGTCCCTTTTTCCAAAGGACCTGG
ACTACACTCCTTCTCTAGGGCCCTTACTGCCCAGAGCCAAAGCAGAAAGAACGTGGGGGA
AGACAAAAAAGGAAATTAAGTTCTCTAGGATCATCTTCGACTTTGAACTTTGCAGCCTCT
GGGCTCTGACTCATCTCCTTGGGTATCCAGAGCTAGTAGAGTTAAAATAGAGTGCTAACG
TAGAGTCAACGTGGAGCTGTTGAAATATGGGTGTATGTTCTCCGGAATGTGAGAGAGAAA
ACCAACAGAGGCAAAGAGACTGAAATGGAAAGGCAGAGAGTCATTTACACCCAGTGGTCA
GTTGGGAATCAAACTTTTCCCGATGTGTCTTCTAGAGCCTTTCTTTCTTGATGGATTTTG
GGAGTGGGACTAGAACTAAGAGCCCTAAACCTAACGGCCACCGGTTTGGGTGGACCGGTG
GCAGGCGATAATTGTGGCTACAGTTTGGAGCTTTATTTCAGGGCTCGGTGGGCCTTTGGG
GGATTTTTTTTCTAGGTGTGATAAAGGCCACCGCGAAGATGAGGTCGTCAAATCCAGAGA
ATAGACCGTGCCTGGTAGGGAGCAAGGGTGGCATGTTTAGAAATCACTTTTAATCCTGCT
CCCCCAGGAAGGTGAATTGGGATAAAGCTTGGTCTGGGAAGGGTTTAGGCCCCATGCAAT
GACTGTGGGAGCTGGATGTGCTGGGTCAGAGAGTGGCATCTAGGGTGACAACTGGCCTGG
TTCGGGAGCCAACAGACCGGTTTTCTGACTGCTTTTAGCATGGCATAGTGGAAAGTGCAC
AGGGCTGGGACTCAGGAGACCTGGCTTTGAGTCCTAGCTCCGCCAATGGCCTACAGCGGG
ACCTCAGACAAATCACTTAACCGCTCTATGTGGCAGTTCACTCACTTCTAAAATGGGGCT
AAGAAAGATATTGAGCCCTGTTTGGAACAGGGACTGTCCCACAGAGGGTTTAATTAATTC
CATTACCATCACTTATGCCTCTTATATAGCGTGGCCTAGTGGATAAAGCACTGGCTTGGG
AGCCAGAGGACCTGGGTTCTAATCCTGGCTCTGCCACTTGCCTGCTGTATGACCTCGGGC
AAGTCACTTGACTTATCTGTGCCTCAGTTTTCTCAACTGCAGAATGGGAATTCAATACCT
GTTCTTCCTCCTACCTCGATTGTGAGTCTCAGCAATAAATCAATCAAACAATCAATGTAC
TTTCTGTGTGCAGAGCACTCTACCAATTACTTGGGAGAGTACGACAGAGCTTTTCGTTCA
TTCACTTGTATTTACAGAGTGCTTACTGTGTGCAGAACACTGTTCTAAGTGCTTGCAAAG
TACAATACAGCTATAAAGAGAGTCAGTCTCTGCCCACAATGGGCTTACAGTCTAGAGGAG
GGGAGACACCTGATAAACACATTCCCTGCCCACAATGAGCTTACATTTCCTGACCGTGTC
GGACAGGAACTGAATCCAGCCTGATTAATTTGTTTCTACCCTAGCCCTTAGAACATTGCT
TGACATATAGTAAAACATTAACAAATACCTAAAACAACAACAACAACAAAAAAGAGGATT
CCTCTGGAGCAAGAGGGAGAATCAGGGGACCAGAATCCAACTTTCCTCAAATGGCACTGA
TGACATCATCAGACTGTGCAGAGAACCAGGCATAAGGCGTGTTGTCTCCCTCTCTTCTGT
AACTGCCCTGTGGGCAGGGAACATGTGTACCGACTCTGTTATATTGTAATCTCCCAAAAG
CTTAGTATAGTGCTCTGTAAACAGGAAGTGCTCAATAAATAGTTGATTGATTGACTGATT
GAAAGAAGGCATGAGATGAGATGACACATGCATCTCCTTGTCTGGTATCTGAGAGCACTT
TCAGGAACCACCTTAGTGCTCCATCGCTATGCTCTTTAAGTGTCTACAGGTGGTTTCTTA
GGCAAGATGATGCCAGTCAGAGAGAGAGAGTCCTGAGGGCCCTCACTTCCCCTTGACTGC
CCCATGGAGTGCCCTCACAGCTGGGTCACTTCCTTCCTAGGCTTCAGGTTTTCCATTAAA
AAATTCTCATTTCTTAAGAATAGCATTGATTAAGTGCTGGGATAGATGCGGGATAATTAG
GTCAGACACATTTCCTGCCTCACATGGACCCACCAATCTAAGAAGCACGGAGAGCATTTT
ACATTTTACAGATGAAGAAAAGGAGGCCCAGAGAGGTTAAGTGACTTGCTAAAGGCTAAA
CAGTAGGCCAGTGGCAGAGCGGGGATTAGAACCTGGGTCTCCTGATTCCCAGTCCTACAC
TATTACCACCAGACCACCTCCAAATTCTTAAATATCAAGCAATTTAATAATGTTGGTATT
TATTAAGTGCTAACTATGTGCCAAGCACTGTTCTAAGTGCAGGGGTAGATACAAGGTAGT
TGGGTTGTCCCATGTGTGGCTCACAGACTTAATCCCCATTTTACAGATGAGGGAACTGAG
GCACAGACAAGTTAAGTGACCTACCCAAGGTCACCCAGCAGACAAGTGGCGGAGTTGGGA
CTAGAACTCACTACCTCTGACTTCCAAGCCCGGGCTCTTTCCACTAAGCCACGAAGCAAT
TTGGGGTAAAATGCTCACACCACCCCTTTTCTTGATGTAAAACCAAGAGTCAAAATGACA
GTTGTATTCAAAATGATGTAATTCATCAAGTCCTTATTTTTATGGTATTTATTAGGTGCT
TATCATGTGCCAGGAGATGTATTAAGCATTGGGGTAGATACAAGATAATCGTGTTGGAAA
CAGTCCCTGTCCCACATAGGGCTCACAATCTTAATCCTCATTTTATAGATGAGATATTTG
AGGCACAGAGAAGTCAAGTGATCTGCCCCAGCAGATAAGTCGCAGAGTCAGGATTGGAAT
CCAGGTCCTCTGACTCCCAGGCCCATGATCTTTCCTCTAGGTCATGCAGCTTCTCACCTA
ATTCTCTGCACCTTTAGGGCAACCCCTAAAATAACCCTAAAGCTCAGTGGGAGCAAAATG
CTGGGGGTCTGACAGGAGGGAGGGGTGGAGGAAGAGGAGGATGAAGATGGGTGGAGGCAG
CAGCGGAGGGCATAGCGAGAGCCTGAGAGAGAGATGGGACTGATGTCGGTGCCTTTCCCT
GCAGTTTCGGGAAAACCTCCAGGATTTGATGCCTTCCTTGCCCAAAACCGACGACTACTT
CCTCCTGCGCTGGCTCCGAGGTAAGGGGTGCAGATGGAGAGGGTTTTCTGGGCAGAGGAG
GAGGCATCCGGGCAAGGCAGACGAGAGGAAAGGATGTACTTAACATTCTTATTTGTAACA
CCCAAATCCTTCCAAGGATCAGAATATTCCATCCCATCTCTCAGCATCTCCCGGTTTCTA
GGGTTTGGGCTGAGGTAAGGGGAGCTGGGAGGGAAATGGCGGTTGTTGGTCCCTAGTCTC
TGAACAAGATCTTGGGAGGAGGGTGGCAGAAATCACCACATCTAAATCCTCAAGTCCTGC
TTCTCCCGTCTCCCCTTCTTGCAGCTCGTAACTTCGATCTGCAGAAGTCAGAGGCCATGA
TCCGGAAGGTGAGTCTGACCCAGATCATCATTTCCAGCTCCTAGTAAGAAGAGTAGGAGG
AGTATAGTATAGTAGGAGGAGGAGGAATATTTATTGAGCACCCACTTTGTACAGTATATT
TGGAAAGATAAAAGAAGTAACAAGTTTCCTCCCCACAAGGGGGAATGGAGAAGACCAACA
TAAAAATATTCACACTTGTAGGCAAAATAAATAATTGAATGTACAATTGAATATATAAAC
ATATATTTTGTAAGATTTAATACGCAGGGTACACTCCTCCTATAGTCCTCAATTGCTTTT
CGATCTTTCCTTGGGTCCAGTTTCTTCAACTATAAACCTTTTCAGTGAGCAAAGACTCTG
AACCATTCCAGTGACTCCATCCCCTGCCCCGGCTGAGAATTACTGTATAGAAAAGAGATT
TAACTGCTACTTTTTCTGATGCCGTGTCTGCTGTGAATTTGAAGTTTGAGTTTCATCGAG
AAGATTCCCAATCTCCTGACCCCTTTGAGGATTTTTGGAGCCTGTTCTGGTCTCAACTGA
GGTTTCTGATTTGTTTATGTAGTACATGGAGTATCGGAAGAATATGGATATTGACAACAT
CTTCAAGTGGCAGGCTCCAGAGGTGAGGTCAAATAACCCTTTACCCTCGAAACAAACTGA
GAACCCACTCCAAATGGAGATTTCTGAGTATGGAAAGGGGTGAAAACTCTCAAGTGGGTC
TTTGGTGCTTTTAGACACTGGATCAGTCCTGGCCTTTAATCGTTAAATAAATATTGCATC
ATGGTCCTGGTGGTGTGAGCAATTCTCTGTGTCTTTGGGCCTACCTAGGTGATCCAGAAG
TATTTACCAGGGGGCCTGTGTGGCTATGACCGGGATGGCTGTCCCATCTGGTATGACATC
GTTAAATCCCTGGACCCCAAGGGACTCCTCTTTTCGGCTACCAAGCAGGACTTAATCAAG
GCCAAAATGCGAGATTGTGAACGGCTCCTTCATGAGTGTGACCTGCAGACCGAAAGGGTG
AGGTGAAGAGAGAGGTTTGGTTCTTACAGGAGAGGTGAGATTCCTAAGGATGGGGAGGTG
AGGTGGAGGGTGATCCCCTGAGCTCTCAAACTCTGGGCAAGGGAATGGGATGTTCTTATC
GACACATAACTACTCAGAGGATGGTCTACCAATCACCCTAATGGGCAAATCTGCAGAATA
TTAGGGTAAGGAACTGCAAAGGAATATGGAATCTGACTTTGATAGGGTGTGTGTATGGGG
TGGCGGGGGGTGGGAGGGGTGGAAGGGAAGAATTGAATCATAAAGCTGGGTGAGACCTTG
ACCTATGCTTTGGTCCAATTCTCTGAGAGCAAATGTGATCGGAGCACTTCCATCTTTGAT
CCAGATTTGGTTTGTCTCCAAGTAGCTAGGGAAGAAGGTGGAGACCATTGTGATGATTTT
TGACTGTGAGGGTCTGGGACTGAAGCACTTCTGGAAGCCTCTGGTGGAACTGTACCAGGA
GGTAAGATGGGACTGGGCTCCAGGTTCCATGATTCTGCAAACGAGGCAATGCCAGTTATT
CCTATGCCTGTGGCACGACTGTATCTCCTAGCGTTTTCCTATTTCCTCCTCCTCGTTGCT
TACATTTTATTTTTAAAAAACCTCCCTCAAAGTCTGCAGCCCACATACATCTAGCCGGTG
CCAACCACAGCCTCTGGCTTAGTCCCACAAAGTGAAGACCACTTTGGCTTGGAAAACCAG
AGGGACTTACCAACTCTCACTCTTCCTTGGCCCCTGGGAAAGAATTCTGGAACCCGAAGT
CTAACTCTGATTAGCTTCAGTCCCGGAAAGCCTAAGGAGCTCCACCCCAGGCTCACAGAA
CCGTTACTTGACTCCACTTGGGCCCAGAGGTTATCAAGGATCCTGGGGTTCATGCTGAGC
AGCTCAGATCTTCAGGGTCAGCTGTCCGTTGGCATTCACCTCCCGTGACCTCTCAGGGAA
GACTCAGACCTTTTTCTGGCTCCCTGAAAGGGCTGGACGCTATTTGATTGGCCATTTCTC
TAGACTGTAAGCTTGTTACGGTCAGGGAGCTTGCCTGCTAATTCTGTTGTATTGTACTCT
CCCAAGCTCTGTACATAGAAAATGCTCAAAAAATGTGATTGATTGATTCATTGATTGATT
CCTGGCCCCTAGTAGGCATTGGAGGAAGTGATATTCCAGCTGAGGTTGTGTGAGATTTTT
GTGGGAATTCCCAGGTGGCCTGTGATGAGAAGTGATTAGTGGGGTTTTTTGAAGTGATTG
GTGGGGCTTTTTTTCCCAGCAGCATTAGATGGATAGACAGGGAATAGAATGGACAGTTCT
GTACCTTGTGTCACCATCATCATTCTCAGCGGTATTTATGGTATGCTTACCTTTCTCAGA
GCACTGTACTAATATAGAGCACAACAGAGTTGGCTGACATGTGCCCTGCGCACAGTGAGT
TTACAATCCAGAGGGAAAGACAGAAGATTTAATAATTTATAATATATAATTTGTAGCTAT
GTACGTAAGTGCCGTGGGGTAGAGGATGGGGCAAATACCCAAAGGTCACAGATCCAGGTA
CACAGAGGATGCAGAAGGGAAAGGGAGCTGGGGAAAAGAGGGCTTAATCGGGGAAGGCCT
CTTGGAGGAGCGGTGACCTTAGTAATACTTTGCATCCTGGGAGAGTGGTTGTCTGACATA
TGGAGGAGAAGGGAACAAAGCACAGTGGTCAGACCTTCAGAGGTCCATCTGGCCTGATGG
TGATCCAGCTCAATCAGTCAATCAATGATATTTATTGAGCACCAACTACGTCCTGAGCAC
TGTATTAAGCACTTGCACTTTACTAAGGTCAGACCCAGTAGGTATTTTGAATATGGTGTT
CCGCCGGCTCAATCCAAAATCCCAATATCCCTCCCCATCCCTGGCTCCCTGCCCAGCCCT
GCCAACTCCTCTAGCTCGATGAGAGCTGTGGCCTCGCTTGCTGCATCTTCCCATCCTGAT
CAGCAAAAAGCCAGCCAAAGTCCATATGAGAAGTTACAGAAGTCATTTTATTCTGCTCCA
AGGGGTTCTCAAACCCAGGCTGGTCTCTATTACCATGCACCGCCTGAGGTCTGGGTTGAG
AAAGGAGAGAGACTATCACTGGAGGCAGCTGAAAAGCATAGGGATCTTAGTCCCAGATAC
GTTAGGGGTATCTCACCGTCACGGTAAGCATCTCTGGGAGTGGTGGAATCTCTGGCTTGG
GGCGACAAAGTGAAGAAGGGAAATAAAGGGTGTAAATTGAGCTCTGACTGGGACTGCCTT
GGCTCCACAGTTTTTCGCTCTTCTTGAGGAGAATTACCCTGAGACTTTGAAGGCTATGAT
CATTGTGAAAGGTAAGCCATGTGGAATGGGGAATGTATCCGATCTGATTGCACTGAATCT
ACCCCAGCAATGTGCTCGATGCATAGTAAGCACATAAGCGTTATTAGAAGAGTCAGTCAG
GGAGGGGAAAAGAATGTGTTTGGGTTGCTGTGGAATGTGATGATGTGGGGAAGCTTTTGC
CTTGGAAGGGGACCATTGTTCAGAGGTGGGAGATTAGAGGGTGTGGCCCAGCATAGTGGA
TAGAGCAGGGGCCTGGGAGTCAGAGGCTGTGGATTCTAGTCCCTGCTTGCCGGGTGACCT
TGGGTAAGTCACTTCACTTTTCTGGGCCTAAGTTATTTCATCTGTAAAATGGGGGTTTAG
ACTGTGAGCCCCATGTGGGACAGGGAGTGTGTCCAACGCTGCCTACTACAGTGCCTGGCA
CATTGTAGGCGCTTAACAAATACCATCATCATTATTATCATTACCTCAATTTCCGGCCCA
GGTAGCATCAGCAGTTACCACCCGCTCACTCAAGGATAGCCATTTCTTCTCTTTGGTGTA
AACTGTCCCGAAGTTCTCATCCTGGGAGCGGGGCAAGAGTGCTGCCTAGTGAGAGTTGCT
GAAGGGCATAGCTCCTCCCAGGATGGCACCTGGAGAGTTTCCAGTACCCTACCAAGTCTC
GGCTACAGGAGGGAGAATCAAACAGAGGCCTACCCATTCCATTCCATTCCTAGCTTGGGC
AGTGGCTAGCGATGGAAATCAATCTGCTACAAGTCAAAACTCACGGGTGCTGGGCAGCAG
CGGCCTGGGAGAGAGTCGAGGGCGGAGATTCAATTTAACTGTGTGGAAAAAGGCAGGAGT
AAACCACTTCCGTATTTTTACCAAGAAAACTCTATGGATGTACTACCAGAATGGTTGAAG
ATGGAAGTGGGGCTTTCTGGGAGAGATGCGTCCATGGAATCGCTATGGATCGGAAACGAC
ACGATGGCATAAGACAAGACAAAAGGGTTATAAAACAGCGGGTGTTGCCCAGCTCTAACC
ATCAGGAGGCAAAAGGCAGGAATGGGAGTCTTTCTTCCCAGCCTCATGACTTGTGTCCTT
CCAGCCACGAAACTCTTTCCTGTCGGCTACAACCTCATGAAGCCCTTCCTCGGTGAAGAC
ACCAGAAAGAAGATTGTGGTGATGGGAGGTGAGGACCACTAAGGTCAATTATTATTATTT
TATTGTGTTCTTCTGATACAACACACTGGCAATGCTGAGTCCAGCTTTGTGCTTGGATTC
CCGACAGCCCATGAGAGCCAGAGTTCTTCTTCCAGGGAGACATAGACTGGCCCCTGAGCA
GTAGTGGTCTTGTCCTCAATTAGCTCTTGACACTAGTAGCTCTAATAATAGTAATAGTAA
TAGATTGATTGAGGGCTGCATTATGCAGAAGGAAGGTGAAAAAAAGTGACACCTACTCTT
AGAGAAGCAGTGTGGCCTCGTGGGAAGAGCACAAGCCTGGGCGTCAGAGAGCCTGGGTCT
AATCCTGGCCCTGCCACTTGTCTGCTGTGTGACCTTGGGTAAGTCAATTGACTTCTCTGG
GACTCAGTTTCCTCACCTGCAAAATGAGGATTCAATAGCTGTTCTCCCTCCTATTTAGAT
TTTGAGCCCCATGTGGGACAGGGACTGTGTCCAACCTGATTACCTCGTCTCGACCCCAAT
GCTTAGAACAGTGCTTGACTCATAGAATTTGTTTAACAAATACAGTTATTACTACATAGT
GAGTGCTTAACAGAAACCATTGAAAAAAGAAAATCACCCTTATTCATTCAGTCGTATTTA
CTGAGCGCTTAGCCTGCTCGTTCTTTGGGACTTGCCTGCTCCCTGCCCCACCTTCGGCCA
TACCACTGACCCTCCCTCTCCCGCCAGCAAACTGGAAAGAGAGATTGCTGAAACTCATCA
GTCCTGAACAGCTGCCCGCTCATTTTGGGGGAACCATGACTGATCCTGATGGAAACATCA
AGTGCATAACCAAGGTACAGGGCTCCCAAGGGTTGGGGGGAGAATGCCTGGGGAGGGGGT
GTTGGGAAGAGTTGAGTCTCCCCTCCCTTGCTTTGCCTGCTCACCCACCGTTCTCTACTT
CCAGATCAACTTTGGGGGCGAGGTCCCCAAGTCCTTCTACATGCGGGACCAGGTGAAGAC
GCAGTTCGAGCACTCCGTCGTCATCAGCCGGGGCTCCTCCCACCAAGTGGAATATGAAAT
CCTTCTCCCTGGCTGCCTTCTCAGGTGGGGTCTTGCCCCCAGCTGCCCCTCTGGCCCCCC
GTACGGTTCTGAATGGGTCCACAGGGATGGGTGTCTCCTCCAGGTGGCAGTTCGTGTCGG
ACGGAGCGGACATCGGCTTTGGGGTTTTTATGAAGACCAAGATGGGGGAGAGGCAGCGAG
CGGGCGAGATGACAGAGGTGTTAGCCAGTCAGAGGTACAATGCCCACATGGTCCCCGAAG
ACGGGACCCTCACCTGCCCCGAACCCGGTGTCTGTAAGTATCCCTTTCCGCTGGTCCTGA
GGTATATTAGGCTGGTCCTCCCCATACTCCTCTCCTGCTCACGTTTCCATACAGAAGAGC
TCGGCCGGAGACGCCATCCTGGGTACTTAAAGCAGCGTGATCTGGAGAACCAGAACTCCT
GGGTTCATTCATTTATTCATTCAATCGTATTTAATGAGCACTTACCGTGTGCAAAGCACT
GTACCAAGCGCTTGGGAGAGTGCAATATAATAACAGACATTCCTGCCTACAGTGAGTTCA
CAGTGTAGAGGCGGAGACAGACATTAATAGAAATAAGTAAATTACAGAGATATACATGTG
ATGTGGGGAGGGAAGGGAGGATGAATGAAGGAGCAAGTAAGAGCGGTGCAGAAGGGAGTG
GGAGAAAGCCTTTAGTCCCTCTTATTGTGGCCTTAGTAAATACCAATTCTGCTAAGCAAT
GGGGGCTTGTGTGGAGACAATAGGGAGGGATAAGTGGACCTCATTAGGGATAGAAGACTG
TGCCCAACCCAATTCGCTTGTATCCACCCCAGTGTTTAGTATAGTGCCTGGCTCATAGAG
TAAGCGTTTAACAAGTACCACCATTATTATAAGCCATTCTTGGACTTGCTGCTGTAACTT
AAGAGAAGCAGCATGGCTTAGTGGCAAGAGCAAGGGCTTGGGAGTCAGAGGACGTGGGTC
CTAATCCCGACTCTGCCACTTGTCTGCTGGGTGACCTGGGGCAAGCCACTGAACTTCTCT
GTGCTTCAGTTCCCTCATCTGGAAAATGGGGATTAAGATTTGTGAGCCCCATGTGGGACA
ACCTGATTACCCTGTAACTACCCCAGCGCTTAGAACAGTGCTTGGCACAAAGCGCTTAAC
AAATACTATAATTATTATCATTATTATTATTAGGGGTGACAGGGGCAGGTGCCTGCCAAG
AGAAGGTGTTCAGTAAAAGGACAAGCTGCAGGGAGGGAAGGGTGGTTAGTCGGTCAGTCA
ATCGCATTTTTTGAGCGGTTATATTGTGCTGACCAGTATACCATGCGTTCGGGAGAGTAC
AATAGAAAAATAGAACAGACCCATTCCCTGTCCACAACGAGCTTATAGACTAGAGGGGGA
GACAGACATTAATATAAACAAAATGACAGATATGTACAAAAGTGCTGCGGGGCTAGGAGG
GGGGATGAATAAAGGGAGCAAGTCACGGCAATGCAGAAAGGAGTGGGAGAAGAGGAAAAG
GGGAGCTTAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGTTG
GCATTAGAGGAGCAAAGTGGTTGGGGTGGGTTGTAGCAGGAGAGTAGCAAGGTGAGGTAG
GAGGGGGCAAGGTTACCGAGACTGAAGAAAGTAGGCAAGGGCTGAGCACTGCAAACCAAT
TCTGGAAATGTCCAAACCCAATTTCAGCCCCTCGCAAACTCCTCCTCCAGAAAGAGAGAT
GTCTAGGACAAATACCTGCAGCCTCTTGGCCGGGCAGATGTAATAGGATGTTGTCTGCAT
CTCTGGCCCTCTGCAGACGTCCTACGATTTGACAACACTTACAGCTATGTCCATGCCAAG
AAGGTCAGCTTCACGGTGGAGGTTCTGCTTCCAGATGAAGGAATGCAAGGCCTGGACAAG
GATCTCACGGCATTCTAGTGGAAACATCGTCTTCTTCATCAAGCCCACCCCCTCTCTTTT
GACAACCCTTTCCCCTTGTTGCCCCAACAAAGAAGGATTAGAGTTTTCCTGTCAAAATTT
TATAGCATTGAGTCAGAGTTGGTGTTGTCCCCGGACTGCCTATTTATCGTGGACATGAGG
GAATGTCTGAGAAGCAAATGTTTGTCGTGAGTGGTTGGGTACCAGCTGGCATGGCCAAGG
AAAGAAGGAAAAAGGAATGAAGACCAAAATGGTGGGGAAGGGGTGCTAAGGAGGCACCTT
GCTAATCATGTGACTGTAGTCCTTACTCTTTCACCTTCAACCATAAGGAAGAGACAAGGA
TTTGTCTATTTCATGGAGGTTTGGATGATTTGGGAAAGGTAAATTTTTTTTTAGCCCTCT
TGCTGCAAGAGAAATAGGTGGTGATGGCGTCGCCCGAACCAGCTTATTTTTCCTGTGAGT
TGGGCCTTATGTCCAGCCATAGCCTCACACACTCTAAATCAATCAGTGAATGGTATTTAT
TGAGTGGTTACCGGGCATAGAACCCATGGGAAAATACAGTATGAATAGGTAGACATGATC
AGAGCCCACAACGAGCTTTCAGGCTATGATCTTGGGCTAGATTGGAGTGAGTAGGAGTTA
ATGGTTCAGTTAAATCGAGACTAATGTGGGGAAAACCACAGGGTTAGAGGCAAGGAAAAA
AAGGTTCAGGAGAGATGCCAGCCATTAACTTGGGATTCCGTTGTTTGTTGTGCTGTGTTT
GGGAAATGCTACGGTTTTTGTTTTATGAATTGACATAGAAGAATTCAAGTAGTTCCTGTG
CTCTCTGTAGGCTGCCTCCAAGAAAGACAGCCAAGAACTCCAGTCTCACCTACAAAGCTG
CTACATTTAAAAGGCAATTCTTTCCTTTGGAAAACAAATTTTATCTTTTTAAGCAACTGA
AAAAGGGGTGCTCAGGTATGAAACACACAAAACTTCAGAACCAATGTAATTCTTTTTCAC
GATCCTGTTATACACTTGAAATAAAGTCTTTAAAATTTTAAACACTCCAAAAAAATTCAA
GACCAACTACTGTACTTAGAAAGCTAACCTAATAACCCCAGTCATGAACTAGAGTCCTAG
AGCAGGAATCTGTTAGTTCATGGACTGGTGAGGGGACAGCAAACAAGGTATTTCATTACT
TTGTTTGGGGGTGGGAAATCCTTTGTTACTATGTCAAAATTTCAAGAAAAAGAGACAAGG
TCTCACTGAGGTTGGGATTTGGAAGGTCTTTTTTTATTAGAAAGGCATACGATTGGTTGC
CTGAATGGAGCCATGGAGAGAAGCTAGGGAAGCTGACATGACTCTTGTCCCTTCGATCAG
TGCTATTTCTTGAGAGCTTACCACATGCAGATCACCGTATTAAGCCCTTGGGACAGTACA
ACATTCCTCTTCTTCCTAGGCAGCCAGAATCGAAAGGGAATGAGGTGTGGCGGGAGAAAA
TGTGGGGCAGAGCCAACAACGGGCTGCTCCTTATGAAACATCTTGACCAGTTAGGTGACC
AACTGACATCAGAAGGAAAATGAAGTTCAAATGAAGGGACACGTCCAAGTGAGGCACTGA
GAGGGTAGCAGAAAGTGAGACTTATTTTGAAAGGAAACTTAAAACAGAAAAATCTCCTCC
TTGGGTCAGCCGATAGATGAAAAGAATCAGTTCAGCATAAATCCCACCTCAGTTGGTGAC
TCCCCCTTTTTGAAAAATTGTATCTCTGTGGCAGGCAGTACTGGGGTAGAAACAAGATAA
TCTGCTTGGCACAGTCCCTGTTCTACATAGGGCTCCCACTCTTAATCCCTATTTTACAGA
TAAGGTAATGAGGCCTAGAGAAGCAAAGTGACTTGCCCATGGTCACACAGCAGGCAAGTT
GTAAATACCCCTGGGTACATCCATAACTGGTCTCGCCCTCCCTTCTTGGTAGCCTCTGCC
CCCCGTTTTTAAGACCAAAGTCTTCATGGCCTCAAAGCAGCAGTGTCAAATAGGAAGGTG
GTAACCTCACTGCTGACGGCTCCCTCAGGACTTCGGATGACAGCATCTCACCCACCCCAC
CATCTTAGTTGAGAGCCCCTCTGTGGCTTGCAGAGAATTCAGGAGTGAGATCCAGTTTGA
ACTTCTGGCTTTGACAAAACTTTGAACTAGCTAAGATTGTAAGAAAACCCTCAGATGAGC
AGCCATTGAGGGATAAATAACACTCATGCCATACCATCCCAATAAGCTACAAAAACAAGG
GAGATGAAATAGAAAGGTTTCCGTTTCAGGGTGATGGATCTGAAAGGAGTATTAAGTGGG
GGATATTAACGAATTTTTGTAAAAATGATCTAGAAAGTAGGGCAAGTTAGAGGCAAAAGC
AAAAAGGGGTAAGGAAGAAAGTGGCGCCAAAAAAAACCCAAGTAGAGTAGCCTGAGGTAG
CTTACAGACAGTGATCTGGTGCGGTAAAATTCTTCTTCTATAAAAAACCCCACTGAGTAA
TTTTTCAAGACTCTATGGGCAGCAGGAAGTCAGGGAGAGGAAGAAGCTGCTCTTGGAGCC
AGGGTTCAGATCACCTTGATGCTGGTGGCAGTGTTGAGCTCCTACACACTGGCTCTTATT
TTTCCATTCTGGAGACTTCAACTTGCAGCCTCTTCTCATCCAGCAGTGATAGGAGAGGTG
CCGACGTTGTTCTCCCCACCCAAATTCAGAGGAGAATGACTGTAAGTCCCCATTCCACCA
CCCTCTAAGATGGACCCTGCTGGTCACTTGTGACCTCTGACCCACCCACCCCTTTACTTC
CCTCCCTCAACCCTTTGGCCACAAAGTAGGGTACAGAACATGGCTTGTATTACTCCAGAT
TATCCCTGCCCTTACTTAGTAGATGGAAAGCGAAACAACAACTTGTAACAACTCTTGAGT
TAGAAGACAGGCCAGGTCTGAAAGACAAATTCAACTTTTATTTCTAGTTTAATTGGAACA
TTCAGTTCTCATCCAGTTCTTCAGCAACATTTATCGGGCACATCTTGGTCTCTTCCTCAT
CTAAGGAAGCCACTTCTTCCACCACTATCTGCAACTCTTCCTGGTAGGGGCAGCTTCTCC
TTTGTCTCTTAGGACGTGGGTGCTTGTGGTACCAGCACAGGCGACCCAAAGCCACAACTA
AGCCCACAAAAGATCCTGTTACAAACAGCACCAGCAGAAAACTAGCTACAAATGCCAATC
CAGACAGTACAAACTGCTTCAGTGTCTTGCAAGACGCTAGGAGGGAAGACAGGCAGATTG
TGCTCATAAGTACCCACTCTTTGGACAAGACCACCCCCACATCTATCTGAGCTGCACTTC
AGACTCCTTCAGCCCAGCTCTCTGACAAGATCTGAGTTTCCAATCAGGGATTTAATGGCA
GCTTTCTGGCCTCTTAGCTCTTTAAAGCTTGTCTCCTCCCCACTAAAATCCCAGCCCCCT
TTGCAACCCCTGATCTGGCAGTGGTACTGTCTCAACTGCCAGACGAGACCATTTCAATCC
TTTTGAGTTGGCCCACTATTTCTCCCCTAATCCCCGCCCCATCCCTGCCACAATTACAAA
TTACTCCACCTTACCATCAAACCACAACGGTGGCTTCCTCTGTACCAGCAGGGGCCCAAC
CACCACCTTATGAACTCTCCCTTCTCCAGGGAATTCTGAGAAACAAAGCCAAGATTAACT
ACATGAAAAGAGAGGACTCTTTTCCCCACAAGACTGAGTGGTGGTTCTAATTTTCCTCAG
ACATGCTTCTTCTGCACATCTGATGCTGAGGGCAGAAAAAGATACATGTCTCATTCAGAG
CTGAACTCTTGAATGGCCCGAATTCCCCCTTAACAAGGAGTAGGGTGGGATCTTGACCAT
CCATATCCATTCATCATATTTACTGAGCACTTACTGGGTGCAGAGCATTGTACAAATGGC
TTGGGAAAGTTCACTATAACAACAGACACAGCTACCAAAAGTTCTTGGGTAAATTAGATT
TAGACAATTCTCAATTTATGACTCAGTGGGAAATCCTGTTGATTCATTAGAGGCCCAAGG
GGCCCAACTGCTACCAGGTTGTCTAACCAGACCAAGCTCCCAACCCTTTTCTTATAGGAA
AAAGGGAGTCCTGAGATAGGCATGACAGAGTGCACAGTTACCTCCAAGCCATGAGAAGAT
AAGGTTCCCAAATACCTTTGTGGTTCATTTCTGATGCGGAACAAATATCCCCACAGCAGT
TACACACAGAGCTCTCAGAGGGGTCTTCCGGAAGAATCCACCTGCCACATGACAGACAAA
AGAAAATATGCAATCAGAAAGCGTAGGAGTTCATTCATTCATTCAATCGTACTTATCGAG
CGCTTACTGTGTGCAGAGCACTGTACTAAGTGCTTGGGAGAGTACAATAGAACAATAACA
GATACATTCACCGTCCACAATGAGCTTACAGTCTAGAGGGGAGACAGACAATAATATAAA
TAAATTACTAACAGGAGCTGAACTGGTTGGACACTACATGAAGAGGGAAGAATACTGCAT
GGGGTTGTATTGGCTGTAGACCTTCTTCTGCCTACTCTAGCCCTGGGAAATTCTTTTCTT
AAGCCATAGATGACTCAGGTGGCAAAAACAGGTTCTAGGGATCACTGGAGTGAAGCCTCC
ACCTTTCCAGAACACAGACCCCCTACTCCTCCAGGCCCACTGCTCTCATTTTAGCATCTA
GTATCCTTAGCTTTGGAGGACTCTATACCAACTCTGTTATATTGTACTCTTCAAAAGCTT
AGTATAATGCTCTGCACGCAGTAAGCACTCAATAAATATGACTGATTGAACAGCCAAAGC
CACCACTGAATGATGCAGCCTAAGAACCACTCCAAGCAAGCTCTGACCTGGACAGGAGAG
GGTCGTATGAACAGGATTTCCGACCAGGCTCAAAGGCTCTGGTTTGGCTCCAAGCCCTCA
GCCAGCATTGGATATAGACCTGGGGGAAAGACACACAGGAAGGGCATGTGAAACACCAGG
TCTAGAACTCTAGCCTCCTGCAACCCGAGGAATAACAAGAAAGTGAAGAGGGGAGAAGTA
AAAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1224, 5764..5839, 6144..6187, 6742..6801, 7008..7196, 7585..7680, 9490..9550, 10624..10707, 11427..11533, 11644..11783, 11863..12032, 14536..14557, 18022..18743
1171..1224, 5764..5839, 6144..6187, 6742..6801, 7008..7196, 7585..7680, 9490..9550, 10624..10707, 11427..11533, 11644..11783, 11863..12032, 14536..14557, 18022..18034
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved