Ornithorhynchus_anatinus Locus ENSOANG00000009054
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus ENSOANG00000009054
Ornithorhynchus_anatinus
ENSOANG00000009054
Contig59
SNORD102, SNORA27
1986..2064, 2333..2464
4818
GATTGTATCCAACCCCATTTGCTCGTATCCACCCAAGCGCTTAGTACAGTGCCTGGCAC
AGAGTAAGCCCTTAAATATTACAGTTACTGTTCTTATCCCGAGACATTAGCCCGGGCAGC
GAAAGGGATTCTGGTGGCACCGCTTTAGTCTTTTTTCCCCCCCTCGTAGTATCAAGTGCT
TACGATGCGCCAGGCACTGTACTAAGCGCTGGGCAAGATACAAGCTAACCAGCTTTGCCC
CAGTCCGCGTCCCCCGTGGGGCTGCCTTAATCCCCAGTCTCCAGATGAGGTAAACTAAGG
CACAGAGAAGTTATGTGGCTTGCCCGGGGTCACACAGCAGGCAAGTGGCGGAGTCATGTT
CTGACTCCAGGTCCAGGCTCTAACCATTAGGCCACGCTGCTCCTTTGGGTGCACGTGTGT
GTTTTCCTCCATTTCGGAGCCAAGCTTAAACCCATATCTGGCTGCCCATGTTTAAGATGC
CTCCAAAGTGCCAATTTGCAAGAGCGTCTAACAACTAAACAGTGGCCAGGAATCTCTCCT
GGAAGTACGTTCCATGACCTCACTGTGCACGATAATACAACGTGTGTTCCTTAGGCATAA
CGGAAGAAACTTCGCAAAAATCCCATGTAAAATGACATTCTGCCCAAAATGGCCCAAACG
GGACAAGGGCATTCCTTTTGAAAATAGTCCCAATATTTACTGGCGGTTGGTGTAATATGC
CTGGGTGATTGTTGATCATGGAGTGTGTGTTTGTGTATGTGTTGTGGAGGGTGGGGGGCG
TCCTTATTTGGAAACAAAACAGAAGGTGGTCACCCTAGGTATGACTTAACCGTACTTAAA
TTTTCCAGGTAGTGTGTAACTTGGAAAATCTCAATTGGTCAAAAAATGAAAAACCTCATT
TCAAACAAAGATAAAGCTGTTTGTGATCTTAGAATTTGCCAACTTCCTATAAGAAAAAGT
ACTCGATCTGCTTTGCCTCTTTGTTTCAGTAATTCGCCAAAATGACGAACACAAAGGGAA
AGAGGAGGGGGACCCGCTACATGTTCTCCCGGCCTTTTCGCAAACATGGTGAGTTTTTAA
TCTCCACAAGGATCGATGGTCAAGCTCTCAGGCTCCAATAACCTCACTGTCTCCCTGATT
CACGCCCTAATGCAGGTACCGTGGCTGTCTAGTCATTGGAAAAATTCTGAGAACTAATAT
TTTAGCAGAAAGTTGTAGCTGTATGAAGTTGTTGCCGGAGTCGAAACGGGAATTGACGTT
AGAAATCATTTTTCCTATCATTTCTAAAGCTCCTGTTACAGCCTAAATGGCAAAGATATC
GAAATATTTTTAAGCTAATTTGAAGTGTTACGTGCTGTTCTCCATCCAAGAGAATATTGT
TATTCTGGGCCCTTTGATTCTGATGTGCTGTATTAAATGTTTGTTCACAGGTGTTGTCCC
ACTGGCTACTTATATGCGCATCTACAAGAAAGGTGATATTGTAGATATCAAGGTATGTTG
TGAAGCGCCATGAAAAGTACGGGGTTTCTTTCCAGCACTGGTACAATGCTGTGGAATAAT
TAGCGGTTTAATGGAAGATCAGTAACCACTCGGTGCGATTTGCTTACTCCGTGCAGAGCA
CTGTACTAAGCACTTGGGAGAGCGTAGAAACAGAATTAGCAAACACGTTCCTGGACTAAC
AAATTTACAGTCTAGAGATTGTAAATACAAATGGTACTATATGTCAACTAAGTTAATAAT
AATGATGTTGATGACAGTATTTAGCGTTTACAATGTGTCAAGCACTGTTCTAAGTACTGG
GGCAGTTACAGCGTGGCTTAGTGGAAAGAGCCCTGGCTTGGGAGCCAGACGTCATGGGTT
CTAATCCTGGCTCCGCCACTTGTCAGCTGTGTGACTTTGGGCAAGTCAGTTAACTTCTCT
GTGCCTCGGTTACCTCTGTAAAATGGGGATTAAGACGGTGAGCCAGGAGTCCTGCTCTTG
ATCTGGTGCTCGATGATGATTGTCTCGTGTGATTGTTCTTTTGCAAGAGCAGAATGAACA
TACCATTTCACCGGCTCTGAGAGCTTATCTGGATCGTCAAAGAGCATCCCACTTATCCTC
AAGTCTTAGTCACGAAGCGTTTCAAGGCCCAAACGTCGGAACTAAGATTGGCTTGTTTCT
GTCTTTTAGGGCATGGGGACAGTACAACAAGGTATGCCTCATAAGTGTTACCACGGCAAG
ACCGGAAGGGTGTATAACGTCACCCAACACGCTGTGGGGATTATTGTAAACAAACAGGTC
AAGTAAGTCAATTTTACAGTATCGAGATAATCTGGGCTTTGTAGTGCCTCCTTTCCCCCC
CTTTCACTTTGCCAGTTAGACATTTCTCTTGTCTTTATTGGTCATTCAAATGGGGTAAAT
TAATTTCCTTTTAAAACTCAAGCAAACAAATTTGTTTGTCTTGTATCCTATCAGGGGAGA
CATTTTTGGAGTATATAAATGATTTGACGGTCATTTGACGGTACGATTGCTCATCTGCTT
TAAGATTTTGAACAGTGTATTCAAACAAATCAAGTAATGGTTAAATAATGTCTTCAGAGC
CGGGACTCGTAAGCGTTTTTCTTTAGGCGAAAGGCGATCGGCGATCGGGTGATCACGTTA
GGGATTAGACAAGAGTGAGTGCGGGGCTAAATGTGATGCTTGGGTTTTTCTCCCATTCCA
GGGGCAAGATTCTTGCCAAGCGGATTAATGTTCGAATTGAGCATATTAAGCATTCTAAGA
GCCGGGACAGCTTCCTTAAGCGTGTGAAGGAGAATGATCAGAAGAAGAAGGAAGCCAAAC
GGAAGGGCATCTGGGTTGAACTGAAACGTCAGGTATGGGGGAGTTAAAAAGAAAAAAAAA
AATTCCGGTGCTAACGTGCCCAATGACTGTTGAAAGGCTCCTGTGTAAAATTGGCATCTA
GTGGGGCTTTCGAGTGAAAGTCAGTCAGGTGGTGTCTGACTAAGCCCATTCCCAGACGAT
ATGGGACCCTATGTGAGAAGTTTATATCTCTGGTTGTACACTCAGCACTAGTGTAGAATA
AGTATGCATCTAACCTTTCCCACTTAACCCATGAAATGAATGAGTTGTTTCTGTTTTTAA
TTCCGATTGTCTGCGCCAAGCCTCTAGTCCTCCTCAGGAGATTCCTGACACTTCAACATC
CCAAATTATCCTCTCTCCCCCAAAAGCCACATCTAAGCGCTGGCCCCATTATCTGTGGAA
TTCCTCAGTCTGGGTAAGATAAGCTTAGAATAATTCAAGGAGACAAGCCAGGCTAAAAAT
AGCTTGGAGATAGCTTTAAGGGAGAGAGAGACCTAGCAGTGAACCAGCCCTCCTACGGTG
CCTAAGGGATTGGGACCGATTATTTTCACCTAGTGATCCGTGACCCTGGGGTTTCTGATT
TAAAAAGGGCCCCCCACCAGACCAGCCGGTGGATAGGATCGCCAGTGAACTATTCCCTCC
CAAATCAGAGAAACTGCTCGATGATGATCTTCCTAAATGATGACTTTAGCAAAAGTCAAA
AATGACTGCGTTATTTCACCGGTTCTGAGAGCAGCTCGGGAGGAGGGTGTCTGTGGGTGG
TTAGCTGGCTTCTGGGCTGGGTTTTAACCTCTCCCCTTCCTTCCCCGTCAGCCCGCTCCA
CCCAGGGAGGCCCACTTTGTGCGAACCAACGGCAAGGAGCCCGAACTGCTGGAACCGATT
CCCTATGAATTCATGGCATAATGTGCGTATGCGTGAAATAAAACTTTTGGACTAAGGAGG
ACCGTGGTGGCTTTCTTTTCTTAAACTCTGGGCGGTCGAGATCGAGCCTGGAGCCGATCA
GAAGCTGGCCTCGTAACGATTCAGGCTCTCGAGTGATGACCGAAAATTTAGTCTGATTTG
GGGGGCGTGACATTTTTACTCGGGAAAACCGCTTTAATCCCTGTAGATCGTTTTGGGAAA
AAAAAAAAAATCAAGAATGCCACTGGAAGTAAAAATAGGAAGATTGGAATGCTGTCTACA
CAGATGGGGGAGACAAGGGAAAGTTGATTTCTCATTAATTTGTTAATGATTGAACGAGCA
GGATAAACATAATGAGCTGTTGCCATTTTGCTCAAAGCTTTTATAGGAGCCTCTCCTTTA
ACCTAAAATGGAATGTTTTGTTAAAACATTCTTGTCCTTTTTGTATTTCAAGTCTCCGAA
GGGACCGGAGGAGATGTTTCCTTCGTGTTAACTATGCAGTAAACCAGCCATAACATTGCA
TTTTAGCCAAAAAGTCACTAGCAGTGTTATGGTTACAGCAGTAACCATAGTGGAGGGCTC
TGTGTTTGTACTCATCTCCCGCTCACTAGAAGCAGCGTGGCTCAGTGGAAAGAGCCAGGG
CTTGGGAGTCAGAGGTTATGGGTTTGAATCCCGCAAGAGTTTGGGCAAGTCACTTCTCTG
GGCCTCAGTTCCCTCATCTGTCAAATGGGGATTCACTGTGAGCCTCACGTGGGACAACCC
CATGACCCTGTATCTACCCCGGCGCTTAGAACGGTGCTCTGCACATAGTAAGCACTTAAA
TACCAACATTATTATTATTACTAGCTGAGTTCTGGGCAGGGGGTGGGAGAGGGTCCCGAG
CTTGAACTCTTTCTGGCTGTGACTGGGCGTGTGCTCTGGGAGGCCTGTGGAGAGACGGAT
AGTGTGACCTGTTGGGGTCCCTTCCTGCATAGACTGCGGAAGAGGGGCGCAGGGTGGGTC
ACAGCCCTGACCGTGGGTCGGGCCCCCTTCTGCCCTCCCATCTCCAAGGAGTGGAGCTGC
TTTAGCACGCGGTGCCTGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1067, 1430..1491, 2169..2281, 2701..2851, 3651..3818
1001..1067, 1430..1491, 2169..2281, 2701..2851, 3651..3740
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved