Ornithorhynchus_anatinus Locus Mono:SNORA13
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SNORA13
Ornithorhynchus_anatinus
Mono:SNORA13
Contig5838
SNORA13
322..453
1453
TCTGGTGGAAGACCGGGTTTGGGTGGGGGAGGCGAGGAGTTCTCTTTCGGGACACGTTA
GGTTTGAGATGTCAGCGGGACAGCCTGGTAGCTGTGTCAGTTTGAAACGTACGGGGACTT
TTTCAGGCCTGCCGAGTTCTCTCGAGTCCTCCCCTCCGAACCACTGCTCGAGGGAGGAAA
TCGAGAGACTCAGTTTTATATTTAGAATCAACACGGGCGCCCCGTTCCCCTTCACCTCCT
CCCTCCTCCTCTTCTCCCTTCTGAATTCCTCCTGGTTTAGTAATCCCTAAGCACTCCTGC
TTTTTATGGCATTTGTTAAGTTTGCCTTGGTGTTGCCCATTCATTTGTGACGGTGATGAT
TTGGGTGTCAAGAGAGGCATAAATTAGGTGCTCTGCAGCGTGTTTGATTTTAGGAGTTAC
TTCCTTTCTTCTTTCGCTGCTCTGAGGGACATTGCAATCATTTTATCGTCTCGGGAGAGT
TTGCTTACCTCCGTGAGGCTTAGAGGTTTGCCACGGAGAGAGATTCTCTCCCTAAGGCTC
CCCATAACGGAAAGGTCTAAGCCGAAGCGTCAAAGTTCAATCATTCAGTCGTATTTATGG
GGCGCCTACTGTGTGCGGAGCACTGTCCTAAGCGCTTGGAATGAACAGTTCGGCAATAGA
TGGCGACGAGCCCCGCCCGTCGACGGGCTTACGGTCTAGACAGAGTTGATTCACCTGTGC
TGGGCAGCGGTGGCGTCGGAAGAATCAGAGGCGGATGATCAAGTGATCAAAATGTCGATC
AGAGGGAACGCCAGGGACTCAGCGTGGCTCAGGGGAAGGAGCTCGGGCTTGGGAGTCAGA
GGTCATGGGTTCGAATCCCGGCTCTGCCACTTGTCAGCTGGGTGACGGTGGGCAAGTCAC
TTCACTTCTCCGTGCCTCAGTTCCCTCATCTGTAAAATGGGGATTAAGACTGAGCCTCAT
GTGGGACAACCTGATGACCCCGTATCTCCCCCAGCGCTTAGAACAGTGCTGTGCACATAG
TAAGCGTTTAATAAATACCAACATTGTTATTATTATTACTGCGCCAAAGTAAAATTTTTC
ATATTTCCAAATTTCTTTACCCAGAAAACTCTATGGATATAAGGGCCAAAATGAGGGTAG
GTCGTTCTGGAGAAGAGGCGTCCACGGGATCGCTTTGAGTCAGAAATGACTCAGTGCCAT
TTGATCATCATTTGTTAAGCGCTTACTACGTGCCAGCCACTGTACTAAGCGCCGGAGTAG
GCACACGTTCATCAGGTTGGACACAGTCCATGTCCCACTTGTGGCTCACGGTCTTGATCC
TCATTTATACTGATGACGGAACCGGGGCACAGAGCAGTGAAGCGACCCTCCTAAGGTCAC
ACAGCAGCCCGGTGGCAGAGCCGGGATCGGAACCCAGATCCCTCTGACTCTCAGGCCCGG
CTCTTCCACCGGGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved