Ornithorhynchus_anatinus Locus ENSOANG00000006965
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus ENSOANG00000006965
Ornithorhynchus_anatinus
ENSOANG00000006965
Contig5795
SCARNA7
2574..2827
14440
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTACAGAGGGTTG
GGGTGGGGGGGGCAGTTCTCGAGGTGACCCTGCAAATTCAAATTCGATCATCCCCAACAA
CAGGCTGGGCCACTTGGTCAATTTTATGTCAGTGAGGACAGCCTATTTTTAGGAAAAAAA
GACGTGTATTTATAGAGGAAATCATGTCCCATCTGCTGGATTAAGGGGGTCAATGAGCAC
GTGGATAGAGGGGAAAGGGTACACTATATTTTGATTTTACAAAAAATTGTTAAATTCCAC
AATTAAAGTTTGCAAAAGAACGGAAGAATTTTGATTAGGGTTGGGCATTTGTGCTGTTGT
AGACAATTAGGGATAAGGGGCTACTATTTGGGATAGAGAAGTATGGAAAGCGGTGTTCCC
CCAGGGATTTATGTAGGGTTGGTTTTATTTGCTAAAATGGGAAAGGATCTTGCAGTGAAA
TCTCCAAGTTTATGGATGACACAAAGCCTTTCCAGATGGCGAAATGCCATTCAGATGGGG
ATAGATTACAGGACGACCTCCCTGAAGCTGCGGGAGTGGGCTGAAAAATGGCCCAGTGAG
CTTCAGGGTAAGCAAATTCAAGGTAATGCCCTTCAGAAAATGTAATCCATACTTCAGCGA
AGTGATGATGAATTTGAGCCATCCGTCACGACTCAGGTAAGAGCGCTGAATCAGCAGCAG
TCCGAAAGGCCCACTGTATGTTGGAAAATTTAGAGCGGGGGATTAATAAATTAAAAAGAA
AAAACCACCAAAAAGAGAGGCCCGTAAGGCTCCAGTTGGGTGTAATCGCTCTGGAGTTGT
CAGAAACATTTCTACCCTCAGAGGCAGAATTCTGAGTCAGGTCGATCGTTGGCCTGACCC
AGCAGTGGTATTTGGGACGATGAAGTGCATTTATGTTTCAGACTGCTGCACTTAGAGCTG
TGGGCAACATTGTGACCGGCACTGATGAACAGACTCAAGTAGTTCTGAACTGTGATGCTC
TTTCACACTTCCCAGCACTTCTGACTCATCCCAAAGAAAAAATTAATAAGGTAGGTCAAT
ATTTAATTCCGGGTCAACAAGGCACAGCTTTAAAGTTCTTTTTGGAGCTAATCAGTAACT
GTTGACACAATTGCAGTCAAGTATTTGTGCCATCGCTTTCGCTTTGAGGGAATCCCTCTA
AGGTATTAGCATGTTCTTAGACCCCAGTAGAACATACTCGGGCATAGGATATTTTGAGAA
ATGAGAAAATAAGCAAGTTTGTTGTATTCTAAGTTCGGGTTGTTGCAGAATGTGCTGTGT
GTGGGAAATCTGGACACACGTATACTAACATGTCTATTACTTGGCTCCAGGCCTGATGAA
ACTATCCGTATGACATGTGGACCCTAGGAAGAAACGAATAGAATACTCCGTTGTGGAAGC
AAAGGGTGCTAAGTAAGAAACAGGGCCACAGACTGGGCTTCCTATGTTAAATAGAAAAAC
GATTAGGTATAATCTGTGCAGACTCTGTGGGAAACGCTGCGTAAAAGATCTGGACCCAAG
ATAAACTCTTAAACGGAATTAGTTTCCTCGTGTACCAGAAAGAGAAGAGAGCACTTCATT
CCAATGTGAAGAAATAAAACAGTGAAATTGCAAAAACCCCTATCGTACTCTTTTGGAAAT
GATGAAATAGAGATACTGGGTGTGGTTGAATGGTGTATGATGTGCCGGGGGGGGTGGGGA
GGGTTTAGTCGCAAATTAGTTTTAGTATTAGTGTAATTTAACTGGTTTGAATCTCGGTAC
AACCGGATATAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGGGGTGGGGAGGTTT
AGTCGTAAAATTAAGTTTTAGTATTAGTGTAAATTTTAATGGTTTGATTTTGTACGACTG
GATATAAGGCTACGGTCAGGGGGCACTGACTCAGTAGTGTTGATTTTGGAGTGCATCTGA
GGCTGTTGCTCAAATACGTGGGCCTCATTAGCAACATTGCCAGTGATTATAGCCCCAAAA
TAGCTCACCCGACTAGCTTAGCACCCAAAAATCTCTAACGGTTTCATCGATGTGGACCTG
TGATCTGATCCAAAGGAGCGAATTTCTTCTACACACTTCTACACAGTGACCTTCGTAGCC
CAAACCCACTCTTAAGACTAGATCGTCGCAACATTTTTATCCTGGAGACAGTTACAGAAA
TATCCTAAGCTAGATCAGCGATATGTGTGTTCCTCTCCCGTTGGCTTCGGGAGCAGTGGT
CATGCTGTTCATTTCCATGAGTGGCATCGAGACCGGAGGTATCCTACCTTTCATTTTGAA
CACGGGGGAAACTGGGGAAGCGAAGAGGGGTAGAAAGAGAAGGATGGTTACCCGACGCTG
CAAGTGCTGACCCGGGACCTGCAGAGGGGGCGGAGAAGAGCAGAGCACACTGGGAAGCGG
AGCGGCAGCCATGCAGACGAGCACTTTGGGCTTTCCCCAGCTTCCACAGGGCCCATCAGA
CGGGCACCAGAGCATGTTCCAGGCCTTGTCAGGGAGCTAAGGGTGAAATAGGCAACAATT
TAACCTCACTGGGCTCCAGGGCCGAAGCACCAAGAAGTGGAGTCGGCGCTGTGGCTCCGT
ATCTGTCTGACCTCTTGCTCCCCCCACTCCGGGGGGTGACTGGGCTGGCTGTGGGGCTCT
TGTTTGCTGGAGAGATAATAAACATCCGCATGTAAGCCTGACTCTAAATTTGGACCAGGA
AAATCTCGTTCCTCCATTCTGAAACTAAAAGAGAAAGTTTTCTTCGTTGCAGTGAGACTT
CCAGCTGTTTTTTGAAATACGTGCTATACCTAGTCTCTGATGGTTGAGCGTATCTCATTA
TGATTTTAAAGAGTAAGTTGAACCAAAAATAATTGGCAGGTTAGATGGCTCATCAAACTA
CCCAAGCGAAACGGCTCCTCGTTTTCGAGGGGCTTCTTTTTTTTCCCTCCCAAGATCTCT
CATCCCAAATGATATTTCTCCCTCCCCCAACTGTCACTTCAGCATTTCTGTGTCATCTAA
GTACTTGTGTATTCACATCCTCCCTTAGCACTTAGCGCCTGTTTTACGTTTCCTACTATT
TAAGCACTAATTCCTGTAAATATCTTCTGTCCCATCCTCCTCCTGTCTGTAAATCATTTT
AGTGTCTGTCAAATCCCTAGAGTGTAAGCTGCACGAAGGCAGGAACCTTGTCTTCTTTTG
TTTTTTCCCAGGGTGCTTCTTAATTCTTTGCATACAAGTGCTCAGTAAATATTATTGATT
TGATCGGAGATATTTATTGAGCACGTACTCTGAACAAAACTCAATGTCATTTTTTTTAAA
TGACATCTCTAAAATATTGAAGAGTTTTTGTTCTGCAGGAAGCAGTATGGTTCCTATCTA
ACATCACCGCAGGAAATCAGCAACAAGTTCAGGCAGTGATAGAGGCTAACCTCGTACCGA
TGATAATACACCTTTTAGATAAGGTAAGTTTTCTTGTTCAATTATTTACGGGGGCAGGGA
CGCTTGTCTCGATGTAAATACGTTCGTTAAATCAGTGGGTCTATTTGAAATTTGATTTGG
AGCCAGGAGCCAAGGACAGTAGAACACTCGGTATTTTTACAGTGCATCTTTATGATGAAT
ATCGTTCTTTTCAATGTCTTTTCTGGTGGCTCCAACATTTGATCCTTTTATCAGAAATGA
GCGGGCCCTGGAGGTAGGTTCCCAGTTCAGAACTGTGATGTGTAAGAATGAAGAGGCAGT
TTTCGAAATGCCAGAGTGTGTCAGAGACAGCCAGAGATGGTTATGAAGTATAATGGCTGT
AGGTCCAAAATGGGGGCATCAAACAATTATGACATACTTTTCCTTACCACTTCCGAAGCA
CGTGTGGGTAATGCTCATCCTGCATTTTTAAAATCAGATAACTACTTTTTTGTGTGTCAT
GTGTTGTTATAGGTGTTTCCTCAAACTGGGCCAAAACCCATGTTGCAATCAAATGTAATT
GGTTCTCTTGGCCCAGACATTAATTAAAACTCTGAAACCTTCCTAGGTGTTCAGCTTCAT
GTTTTCCTACACGTTGGATTTGCTTAAGAGACAGTATTGTGGTGTTCCACATTTTTCCTC
TTTTTCAATTGTCTCGAAGTACAATATCAAATTCAGATGGATAAAATAAACAGTGTGACC
TGATATCCCATTTCAAATCTTAACATATACTTCTGCCAGCATTATACTAATTGAAAGAAC
TGGGATCTCATTTCAAAAGATTACAATCCTTAGATTTAGATCACTGGGATTAATTTACCT
TTAAAATGTCTAGAAGTCAGTTGTTGACAAATTCCAGTCAATTCCATTTTGGAAATTCCA
TTTCCAAAACCCCAAATCAACCAATCACACCTATAGTAGCATTGTCGTGGAAGGGGTGTA
CGTTGGAAAGAGGCCAGTATTTTACTTTGCCAACAGTTGAGCACTTTATATTTCTAGGTT
GATTCTTGACCATTTGATGGATTTTTGTGGAAGTTGTTTCATTTCTCAGTCAGAAACATT
TTTTTTCTAGCTAAGAAGGTTTGGGTATTCTACCTCAGGTCTGCATGTTAATCCGTAGGT
CCTTTCATCTGAAACAACTTTTAGAAAAAGACTCTACGGAAAATGTATTCTCTCATTGGT
TTCTTCAAATTCTTAAGTGTGTTTTCCCTCATTTTAGGGTGATTTTGGCACTCAGAAAGA
AGCTGCTTGGGCTATAAGTAACTTAACGATCAGTGGAAGGAAAGATCAAGTGAGTAAAAC
TTTAACTTCAGTAGACCAAATACAACAAATGAGCAACTTGTTTTGAGTTCGGGAAATTTA
AGTAGCAAAGTTTTAACCACCATAGAAAAGACATCTTCTGATTCTTTCATCTGGGACAGT
GACAATTACAAAAGGGATGCCAGCTCTTCATTTAGGGAGGAGCAGGGAAAGTCCGTTACC
CTGCCCTGGACCCATTTAGGCTCGTACCAGAGCTGGGACCCAGTGGGGAAACGTGGCAGT
TTTATCATCATCGATAGCGTGATGTTGGATAGCAAAGTAAGAGCATGAACAGAAACTCCT
TACCATTGGCTTTATAGCACACTTGCTCACCACCTCCTGCCGTATCTCACTAATCTCGTA
GTACGGTGCAGCCTGCACACTTTGCTCCTCCAGTGCCAGCTTCCTTGCTGTGCCCCAGTC
TCACCTAGCTTGCTGCTGATCCCTTTCCCACATCCTCCCCCTAGCCTGGAACTCCTTCCC
CCTTCACATTCACCAGGTCACCACTCTCCCCACCCTTTTTTAAGTTCATATCTCCTCTGA
GGCCTTCCTCTATTAAGCCCTCTCTTCCCTGGCTCTCTTCTGCATCATCAGTGCACTTGG
ATCTCTGACCTTTGGCCATTTGATATTCACCCCATCCTTAACCCCACGACATTTAGGTGC
ATATCTGTAAAGTGTACATATTCATATCTGTAGACTTTAGACTCTAAGCTCATTGTGGGC
AGGGAATGTGTCTGCAAACTCTGTGGTACTCTCCTAAATGTTTAGTATAGTGCTCTGCAC
TCAGAGCTCAGTAAATACCACTGACAATGATAGTAATGGGGAAATCAAGATAAGCTATGA
AATAAATGCCTGAGTGTTTGGCTGAGGGGTAGCATGAAAGGAGAGAGGGGAAGGAGGGAG
GGCTTACCTTTCACTCCATTTTCCATCTTTTCCCACCAATGTGCCACCACCAGCCAATTA
AGCCTTTGGAACCTCAGCCGATCCAGAGTCCAAAAACTCAGAACGTGCTTGGGGCAAGAG
CAAGGCTGGTATATCTAACCTGCCTCTACTGAGCTCTGATATGGGAACTAGAGAAACTGG
CAACCTGATCCACAGCCCCGTGGGAATCCAATTAAACTCTTCCAAAAGGCAGGATCAGGA
TGTGAACCTGCAGCCTATGAAAAGGAGCAAGAAGCAGAGGTGGTGTCTTGTTTTGACTTC
TGGCCCTCCTCCTGACTCCAGAGAGTGGGGACAGATACCTGTGGTGCCTATCAGTGCCTT
CTTTTCATTTGTCTTTTCCCCCCAGAGTTAGTAGTCCCTTTTTTCTCCCCTGTTTCTAAT
AAGTAAGAACCTATTTTTCAACAAAATATTTGTTAAAAGCATTTTCATTTGTATGGTTCT
GAATGGTAAGGGCTGTTTCCTCAGTATGTCTTTGAGTCTGTATATCGACCTACAAAGTTT
TAGCCATCTCCCAGTTTTGGGGAACTTTGTTCTGAATTTTCTCAGTTTTCAAAAAAAAAA
GTCAGTCATTTTCATCTCAGTGGTATTTGGTGTTTGGACAGAGAATGGAGGAAAGTGTAT
TGGATTTTTTGTTCCCCTAGAACCTTTTCTCCATTCTCTAGGTACATATTTTCTTGTCCT
TTCATCTCCCTTTTATTTCCATCTCTCCTGGAATATAAAGTTAAATTAATGGAGAGAGGC
TGTTCAAGAGCTTTCCGATTGTTGTTTAAAGTGGCTGTGAGTCTGCTGTATTAAAGGGGA
ATCAGCAGGCTCTCTGCTTGGTCTGTGTGTTAGTCCGTTTAATGGGTCCTTTGAACTTCT
CAGACCCAGTTAGTATGTCTTTTTACTCTGGAAGGACAAAAATTATATCTTCTACTTCCC
CACAAAGTCTGGAGTTAACATGTATAAAATTCAAGTTCTTAATTTCAATATGCCTGTTTT
TTTCCTTGTATTCTCTTTCCATAGGTGGCATATCTTATCCAACAAAATGTTATCCCACCC
TTTTGCAACTTGTTAACAGTAAAAGATGCTCAAGTTGTGCAAGTGGTGCTGGATGGATTA
AGTAATATATTAAAAATGGCTGAAGATGAGGCAGAAACCATAGCCAATCTAATAGAAGAA
TGTGGAGGTAAGTTGCCAAAGTGCTCACAGCAGCTAGTGAAGCCTAATCATTTTGCCAGC
CTTTGCCATTTACTTCTTGTCTGAACTCTAAGCAACATTAGAATTCTTTATCTTTATTTG
TTTCCATTCTTGGAGTCGGTACCAAATAAAACAAAGTTAGTAAGGTATTGAAAAAATCCA
TTATCTTCTCCACAAGATAACTGAATAGGATTTAATTATCAAGGCAGAATTATAAACTGG
TTTTCTCTAAAAAGCAATTCATTTTCTGTTAAATTATTATTAATAATAATAATAATAATA
ATAATAATGGCATTGGTGACTGTATTGTGCCAGAGTAAGTGCTAAGCACTAGGCTAAATA
CAACAGCATGGACAGAACATGGGGCTAGGAGGCAGAAGGTTGTGCATTCCAATCCAGGCT
CCGCCACTTGTCAGCTGTGACCTTGGGCAAGTCACTCACTTCTGTGCCTCAGTTTTCTCA
TCTGTAAAATGGGAATTAAGACTGTGAGCCCCAAGTAGGACGGGGACTGTGTCCAACCTG
ATTGCTTGACTCCACCCCAGCGCTTAGTACAGTCCCTGGCACACAGTAAGTGCTTAACAA
ATCCCAGAATTCTTATATTGAACACAGTCTCTGAGGACACTTCCTTCCCCTTCTCTTCCT
CTCCTCTCCCCTCTGACCACCCCCCAATCCTCCAATCCCCAATAGACTCACAGTCCAGAA
GGGAGGGAAAGCAGCTATCTTATCCCCAGTTTACCAGGGAGGAAACTTGGAGCAAATCAC
ACACATAATCTCTCTGTGCCTCAGTAGCTGGGCAGTGGCAGAACTTGAACCTGGGGTTCC
CTCTTGCCAGTCCTGTGCTTTTTCCCCTAGGCCATATTGTGTCATTAGTGGAACCCAATT
GAAAGAGCCTGTTGAATTACTCCAGTGAAGTAGAAAGTCCAAGTTTTCTTGGCAGTCAGA
ATTTAATTTTGCTCAAACATGCTCTTATTTTCTACCTCTCTCCAAACAGTGTCCATTTAA
CTCGTATTGGAAAAATGCTCCTTTTTCTACAACTTCATTTGTAAAGGGTAATGCTGCTCC
AGGTTCAACTGAGACAATACAAGGCTCCGGGAGAGGCAGTATCGATGTTCCCAAACAGAA
AATTCTGCTGTGGGTTCACTTAATCCATATAAGGATTAAAGCAGCTGTATTTTATTGGCA
ATACATGCCTCCTTATTTCACCTGCCCCACTCCTGTCATCAAATTCTATGTGTTTGATGT
CCTGGAAAGGATAGTTTTGATTATCAGATATCCCACTCTCCGGCCAATCTAATGTTACTG
CCATTTCTTTCACTTAAAAGAATGAAATGCTTCTTGCAGGTCTGGAGAAGATCGAACAGC
TTCAAAACCATGAAAATGAAGACATCTACAAACTTGCTTATGAAATCATCGATCAGTTCT
TCTCATCAGATGATGTAATAATTTTAAACTGTCTTAACTGTATTTGTAAACGTGGTGGTA
AAGAAAAGATTAGAAGTAGTGTAGTGATAACTCTGCATATTAAGTTGAAATTGAAATGAA
ACAGAACTATTCTAAGAAGCCTGTGAAATCAGCAGCTTTTGCTTTCTCTGGCTGCTATTT
CTAGGCAAGTGCCTCATTTTAAAATCCCTCCTTTTAATAATAGTACAAGGAATACACAGA
AGATAGTTTTTTGCCGTGTTAGAGGAAACAGTTGCACCTCCATACATTTATAGTAAGCTA
ACTAGTTTTACATTGAGGGAAAAAAAAGACAAAGCACATTACTGCAGTAGACCAGTAGCT
ATTCAAAGTAGGTGCTGCTGTCTTTGGATCCATAATTTCAGTAATCCTTTTTTCCCCAGA
TGAATAACCATCTGCAGTGATTGTTCTCCTGAATGTTCCCATTTGGCTGCCATTCTGGGG
GTGGTGGGGAAGCAAAGCTTGACGATCAGAATGGAAGTTAGATCATGTTTATGTCTGCAG
TGATGTCAAAAATCAGTATTAAGTAGTTAAGACAACTTAATTCTCTACTATTATTTTTCT
TGGAACTTTCAACCATAGCAGTTCAAAAAGAATACTCTAGGATACTTCAAAAATAGAATA
TTTTAGAATGCCGTATCTTATATAGCTTATATAACCCAGCAGTCCGTAAGCCTTCTCAGA
CCATCGGTAAACTCTCGGGAATTACTCCATAGCTGCTGACAGTCTATGTGAGAAAACATG
CATTTAAAAAATTGATTCATTGATGTTAATAGAGACTAGTAGATCATTTTAGGTCAATGA
AAAATTGTTTCCATATTTCTCTGTGAAAGGGATATTTGAACTGTTTTTCTGGGTTTTTTT
GATCAGATGTGATATTTTCAAATTCCAACACAATTTACTTTCAATCTCAAAGTCCTCATG
GTTTTGAAAACCTGAATGTGAGGGGGAGTGGTTCTTTTGGGGGGAAGTCATAGGACACAA
TTCTAAATGATCAGATGGTCATTCTAAATGACCTGGTTTACTGTTTACATCAGGAGCCGG
TTTTTGATAAACAGATAGATACCTGATAAATTGGTTTCTGCAGTTTCCATCCTATCTGGA
GTAATCCACATTTTAAGTTAACCAACTCTCTTGATCTGTGATCTCCCAGTATTTTTGGTT
GGGAAAAGTGGCCTCAATACCATTTGTATACCCTCAGCTACTACACTGGCCAGTCAGGAG
TTCTGCCCAGTTCCTTAGGAGCAGTTGTTTTCTTTTTTTTCTTCCATGTGGAGGGGTGGC
GTTTCTCAGACAAAATATATTGAAATCAAAACTTTTCGCTTTTTGTTAGCCTTTGGCTGG
TGACACTCCTGAAAGCTTTTTTACTCTATTTCTAAGCCTCCTTCAGGGTTGTTTTTCAAG
GAACTGTTGCCACTCATTTATGCAAGCAAATGTAGAATGTCGTGCGCTCTGTTCAGCAAA
CTTAAAATATCTTTTTCCCAGAGCTCGAGACAGACTACTGAGTGGTAGGACCAAAGGAGA
CACAAACTTTGTGTGATGCCTGGTTGGAAGAGATCATTCATTAATTAGTTTCTAGGCTCA
GGATGCAGCACCAAAACTTAAATTTCCAGCTTACGCTTGTGGGTTCTGGATTAATTGGGT
CGCTCATAAATTAATGATGACTCTTTTTTTGAAGAAAATAGGATTCTCCCAGTTTCTGCT
CCTTGAGAGACTCTTCCTAATGAAAAGCCTATGTAGCTAAAGATTTGAAAGAGGGGTGGG
GGAATCGATTACATTCTGAAATGGTACAAAGAATTGTTTTTAGAATATAAGCTTACTTAA
CCTGTTTTCTCTCTTTCTTTTTCTTCCCTGTGATTCCCCCCTCCCTCCCCCAACTAGATT
GATGAAGATCCTAGCCTTGTTCCTGAGGCAATACAAGGTGGAACGTTTGGGTTCAATTCA
TCTGCCAATGTACCAGCAGAAGGGTTCCAGTTTTAGAAAGATATATTGGAAGTTAGGTAC
AATGCAGCACTGATATTTAACAAAAAAAAAAGTTTGATCCATCATGCTTGGCTCATGGGA
TCTGCTGCTGCATTAAATCGGGGAAAGAAAATGTGAAGATTTCATTTGGAATCCCAGAAA
AGCCCAAATGAAGTCAAGGTGGCGAGTGGGTGCGAGTGAGAATGAGTGGCAAAATGTAAC
GAAAAACTTCACACGAATGCTTATTTAGGTTGTTCAAAGTCAGAAGGGCTACAGGTCAAA
GATCTTCAATGCCTGAGAAGGAGCATTGACTTAGTAGAGCCATTGGGGGGGACGGTGCGG
TAACTCTCATCTTCGAGCCTCGTAAGCCTCCGAGAGAGAGTAGGATGCCCTCTAAGTCCA
AGGGGAATGAGCCCAGGCCTCGCTATGAAGCACTGTGTGAGTGGACAACATTGAGTGAAT
GTCTGGTCTCGAAGCTGTGGAGCCAGGCTCATCTTTCCAATCTAGGGCTTTTCACTCGTG
AAGCGGATTCCTAGCCCTGGAGCGGCGTGTGTACGAGAGTATGGTTGTGGTGCTGTCTGT
GAACGCATGCAAGCTTGAATCGCCTTCAGGGGGCTGACGACAAACCTAACCAATCATCAA
AGTGAGATCATAAGTGTTAACTTACACTGGACATGAAAACAAAGACCGGTTTAGCAGCAG
ACTTTGGTTTACTCCTGCAGCCTGTGTTTCCTTTCCTTTTTTCCTTTTTTTTTTTCCTAA
GTTGTTTTTAATTTCTTTACCTAGTACAGCTTATTAGTTGCTTGTCGAGTCAGAAAACTT
TTCAGGAAGGCTTCCCTGTGCATTTGCACCAGATGAATGTTTGATGTTATGAAAAGCTTT
TCCATATCATCAAAACTAATTTGTGTAGACTTTTGCATGAAAAATCATATAAATTGCCCT
CAAAATAGACTGTGTTGCAGTACACACAAGTCGCCATAATAGTAGAAAACAGTAAAATGT
GCTTTAAAAGCCATCCTTTTCATTTTCAGAGATAACATAAAGATCTTTGCATGTGGTAAT
CTACAGCATAGTTCATTTCTAGATTTTGTTGAGTCCTGTAAAGAAGAAGAAGAAGAAAAA
AAAAGTTTCAGTTGTGGTAGAATACCGTGCTGTGTTTAAATGTTACTTGTTTTCAAACTT
TGTTTTCTATGAAAATGATATGGAAACTTCTAAAATGAAATTTGGTGCATATGTACTGCC
GAATAAAGACCGATGAAGAGGTGTGAATAGATGTACAAATCAAGTAATGGTTTGAACACC
TTTAATAATATGCCTAATCTGTTCAATTGTTTTAGAATCTTTTTATCTTAGATGTAGGCA
GCCATGAACAATCTATTTTGAGCCACTTTAGGGAGAACACTTTGTATTTTTAAAACTTGC
ATAAAAGGCATGCAAGTGGTTTTTATAAATTGGAATAATACCTCAGTTTCGAGGTTCTGC
ACACTAAATTAATGGGACACGAAAAAATTTGTACAAAAAGGAGAACTCTTTATAAGGTGG
CTCATTGTAGGAAATCCTGTGCCTTCCCCTTTGAGCACAAGTGTTGCATGAACAACAGTT
TGCTATAAGAAACATACCAGATTAGCCACCATTAGCATCTATATCTACTTTGTGTTGAAA
AATCAACTGGTAATTCTGAAACACTGTAGAATGGATAAAGATTATTTTGTGATCATAATT
CTTTGTTGGACTAGAGTATTTTTGCAGCATTCCTTGTCATCCGAAACGTGGTTAAAGTTG
AAAACTAGAAGCAGCAGAAAACTAGCTTGTAAAATTTATCCAAGTAGAATTCAGGCTAGG
GCTGTCTTGGGGAAATAAACATTAAACTTAAAGCAATGTTTTACATAGGGTGTGGTGTGT
GTGGGGTTTTTTTTAAGAAAGCAGCAGTGTTTTACATAGGGCGGGGGGAGGGAAGGACGG
AGGGGTTTGAGAAAACAACAGGTTGAAATTAACAGTATGGAAGCAGTTCGGTTTTCCAAG
GGAAGTTCTGAGATGTCTGGACCTCTGAAGCTCTCGATTTTGGCGAAGAACCAATTGAAG
CCAGAGTCGGAGGGAAAATATTTCCCGTAAAGTGTCCGTGCACTTTTCCACAAAGTGTAT
ATGCATTGTGATGCTCAAGAATTAGAGCTGGTGGGGAGAACGCTACCCATCTGAACTCCC
TCATAGATGATGTTTTTGCACCCAGGCAGACCTTGATTTAAGAGGTTTCGAACCGAGTCG
AACAGCCCGAAAATCGTTTCTAAATTTACACCATTTTGACTTTAGAACTCTATCCTCCTC
AATGGTGCTGAGTCTGGGGGTCCGAGTAGGGATGAAGGCTGCAGGTGAGCTGTGGGCAAA
TGGGGGAGTTACCTTGAAGAACGGGGGCAGGGGAAGAGGAGGAAAGTTTTTAAAGAGGAT
TGGGGGTGATGGGGGAGGGTTAGGCAGGGTGCGAAGACTGCGATGGTGGGTGGTCGGGAG
GTGGGAGGGGTGAAGGGGCGATTCACCAGGAAGGGTTGGCATGTCTATTTTACTCACAAT
GGTATAGAAGTGGGCACCATATTGAGCAGTTGTAATTACTCATCTATAATTAAGGAGGAA
GCTGTGGTTTAAAAAAAAAATCTGGCACCTGAGCATGGTTCAGGAACCAAACCTGCACTT
GTAAAATTGTTCCTATAAGAAAAGTCGGTCTGATTTACATATTTCCACCTAAGGGATTTT
CAGGAACCGCCTGTCTCAATAAACAAAACAAGGATTCCCTGTACTTCTTTCTTTCCCCAT
CCCAACACAGAAGTGTAAGGGTTCAGCTGTAGCTTCATGTAAAATGATTTAAAATTAAAA
TTATTACTGGAGATCCACAATGTATGTCTTGTTTAAATTCAATCTTGACCCAGTAATTGT
GGTGTACAGAGATCTTCCGAAAAACACCAATTTCCACTTAATATCTGAGTTGAAAACGGT
TTGACGAGAACCTTGGAGATCGTTTGTATTAAGCAGAAATCCTATAAGAGCAGACTCTCC
TCGAAAAAGCCTTCGCCTTTTGAATAAAAGTTTAATGCCAAACAAATCCGTTCTAACGGG
AAAGGTGATTTTGTGTGATAATTCTAGACTTTTTCAGAACCCAAGACTTCCTCTAACTCG
TGGTGCAATTGGTACTGCTAATTGAGAATTTGTGATTATCCCGACGTACGTCATTTGTTT
TGACTAGAGAAAAAACCTCCCATTTCGTCAGGACTCGTGACAAAAAACCTCCCTGCTGTT
CTTCTTGTGCCTCTTTTGCTCTCCGGGAATTTAGCACCGGTTTCTCCACTGTCATTCATT
AATTCAGTAGTATTTATTGAGTGCTTACTATGTGCAGAGCACTGTACCAAGCACTTGCAA
TGTACAATTGGGCAATAGATAGAGACAATGCCTGCACAGTGACGGGCTCACAGTCTAATC
GCCTACTCGGGGTGAAGAATGCATGGCTGGTAAATTCCTAGCTTAAACACCTTTGTTGTC
AGGCCTAAAAAAGATAGTCCTGCCTTGAACAGAGAGAAATGTAGGTGCTTGGAGGTGGGG
GAAGTAATGGGGTTTCTCCCTTCAGAGGCCAAAAGAGCCGTCCGGTGGGTCCACCCAGTC
GGCTCATCCCTCCAGCTCCCGCTACGTGACGGTCCAGAAGGAACAAAATGATGTCTGTTG
CTCAGCCAGTAAGGACAGTAAGATGATGGATCAACTAACCCCAGCTACACTGTGGTAGAG
GTGAGGATGTGTTTCTAGGAACCACGTAACAGCTAAGAATTACTAAATGGTGGCCACTGA
CAGTCTTCCTCTCTAGCTCGTCATTCAGTTGTATTTATTGAGCGCTTACTGTGTGCAGAG
CATTGTACTAAGTGCTTGGAATGTACAATTGGGCAACAGATAGAGACCATCCCTGCCCAA
CAACGGGCTCACAGTCTAAAAGGGGAAGACAGACAACAAAACAAGTAGGCATCAATACCA
TCAAAATAAATAGAACCGTATATATATACACATCATTAATAAAATAGAGTAATATATACA
AGCAGCGTGGCTCAATGGAAAGAGCCCGGACTTTGGAGTCA
  Untranslated Region
  Coding Sequence
  snoRNA
281..1069, 3398..3502, 4717..4788, 6744..6906, 8259..8353, 10257..13440
932..1069, 3398..3502, 4717..4788, 6744..6906, 8259..8353, 10257..10355
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved