Ornithorhynchus_anatinus Locus ENSOANG00000006255
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus ENSOANG00000006255
Ornithorhynchus_anatinus
ENSOANG00000006255
Contig5685
SNORA7, SNORA7
1946..2098, 3645..3797
18917
AGCTCCACGAAGCTCCCCTCTGTGGGAGGCGCGTGGGGGAACATTACATATCCCAAAGC
ATATTCCAGCCACACCTAGTTTAGAGAGGCAGTTTTGCCGAGTGGATACACCTCGAGCCC
GGGAGTCAGGAGGACCTGAGTTCTAATCCCGGCTCCGCCACTCATCTGGTGTGAGTCGTT
GGGCCAGTCTCTTAACGTCTGTGTGCCTCAGTGCCCTCATCTGTAAAATGGGGATTAAGA
AGGTGGGCCCCATGTAGGACAGGGACTGTGGCCAACCCGATTTGCTTGTATATACCCCAG
TGCTGAGTAAAGTGCTTAGTAAACTGCCTGGCACATAGTAAGCGTTTAACAGATACAACA
ATCATCATCAACAAACACTTATTTGGGCTTAGCACTAGCAGAAACTGATATACGACAAGC
TCTGGATTCCTGGCCCGTATTGGAAGTGACGTCTTCCCCGCTCCTCAGAGGTTTAATGCT
CTCTCATGAGCCCCCATATGTCAAGAATATCTTAATAATCCGTCTGGCATACAGAGTTTC
TAAATATCCTGGGAAAATATGCATAAACCTCTTGAGAGGTAAACGTTTCAGGACTCACCA
TTTTCTGTTGATTCGAGAAACACGCCCCAACTCTACTATAATTCTGGGGTTGACACTAGT
AGAGCCCTGTGTTAAGGAACAATCAGACGGCTAACCACTTAGTACAGTGCTCTGCACACA
GAAAGCGTTCAGTGTGTACCAGCATCATTAGGGGAAGCAGCGTGGCTCAGGGGAAAGAGC
CTGAGCTTCGGAGTCAGAGGTCATGGGTTCGACTCCCGGCTCTGCCACTTGTCAGCTGTG
TGACTGTGGACAAGTCACTTCATTTCTCTGTGCCTCAGTTACCTCATCTGGAAAATGGGG
ATTAACTGTGAGCCTCACGTGGGACAACCTATATCTACCCCAGCGCTTAGAACAGTGCTC
TGCACATAGTAAGCGCTTAACAAATGCCAACATTATTATTTGCCATGCACATGTATACAG
CCATTTTTTCCCCCCCAACTCCGTGTCGTGTTATTATACCCAGACAGACGTGCATTCTCA
GGAGAGGAATGTTCCCTATTGCTGCTGTCAAGTGCTGTCTATGTTGTGTATTGGAAACAC
ATGCTCCGGGAAAACTACAGATACTCCTTGTCCTTTGATAGCGTGGTTAGCGAGATTGTA
GACCACCATCTAAAGTATATACACTGTAGCTCATGAAAATGATAGCGTTTCGCTTTACAC
TTTCTGACTCGTGTTGCCTTTTCCTTCGTTTAACGGTTTTTTTGTCTCTCGCTCTAGCAC
ATAGACTTTCCTATACCTTGTCCACTTCGAATGTTTGAAATGCTGGTAGTTCCTGAACAG
GATTATCCTTTAGTTTGTGTTGGCGTCGCTAGAGGAAGAGACTTCAACCAAGTGGTTCGG
TTTGAGACCGTCAACCCAAATTCTACCTCTTCCTGGTTTACAGAATCAGGTTTGTGAAAT
CTAAGATTTGTTTATCAAATGAATGAGTAGATTCTCGAGGTAATGAAATACTGTATGTGA
ATCGTAGCTAACTGGAATCCGTGTCACATTATATAGCGGAAGCTATTTGGATATAAATCT
CAGTGCTCTCTTTGAGATCTTTTCCATTTTTCTTTTTATTCTTTTCTCGAAGAACTTCAT
ATGCACTTTTATAGTTCTGGTGAGCATGTCATTTGTCATGAACGCAGCTCTGTTCCATCA
GATAATAATAATAATGATAATAATTGTGGTATTTGTTAAGTGCTAACTGTGTGCCAAACA
CTGTACTAACCACTGGGGTAGATACAAGTTAATGGGTTTGGGCATAGTCTGTCCCACAGA
GGGCTCACAGTCTTAATCCCCATTTTACAGATGAGGGAACCTCCTGTTGAGATTGCACAC
GTGCATGTTGGAAAAACCAGAAAAATGGCTTTAGGCGCACCTGGAGAGTTTCCAGTCCTT
TACCAGTCTCAGCTAAGGGAGGGAAAGTCAAGCAGAGGCCTACCCATTCCATTCCTAGCT
TGACAAGACAGTAATCCCTTAGTCCTTCGGGAGTGATTCAGACTATCACTGCAAGAGAGT
GGAAAAATACTGTGCAGTTTGTCTTTTTAAAAGAGTGTCCCAATCCTTTGCTGTAGTTCA
TTCATTCAGTCATATTTATTGAGCCCTTACTATGTGCAGAGCACTGTCTAGCACTTGGTA
GTACAGTTCAGCAACAGAGACAATCCCCTCCCCAACAATGGGNNNNNNNNNNGGACTCAC
CATTTTCTGTTGATTCGAGAAACACGCCCCAACTCTACTATAATTCTGGGGTTGACACTA
GTAGAGCCCTGTGTTAAGGAACAATCAGACGGCTAACCACTTAGTACAGTGCTCTGCACA
CAGAAAGCGTTCAGTGTGTACCAGCATCATTAGGGGAAGTAGCGTGGCTCAGGGGAAAGA
GCCTGAGCTTCGGAGTCAGAGGTCATGGGTTCGACTCCCGGCTCTGCCACTTGTCAGCTG
TGTGACTGTGGACAAGTCACTTCATTTCTCTGTGCCTCAGTTACCTCATCTGGAAAATGG
GGATTAACTGTGAGCCTCACGTGGGACAACCTATATCTACCCCAGCGCTTAGAACAGTGC
TCTGCACATAGTAAGCGCTTAACAAATGCCAACATTATTATTTGCCATGCACATGTATAC
AGCCATTTTTTCCCCCCCAACTCCGTGTCGTGTTATTATACCCAGACAGACGTGCATTCT
CAGGAGAGGAATGTTCCCTATTGCTGCTGTCAAGTGCTGTCTATGTTGTGTATTGGAAAC
ACATGCTCCGGGAAAACTACAGATACTCCTTGTCCTTTGATAGCGTGGTTAGCGAGATTG
TAGACCACCATCTAAAGTATATACACTCTGTAGCTCATGAAAATGATAGCGTTTCGCTTT
ACACTTTCTGACTCGTGTTGCCTTTTCCTTCGTTTAACGGTTTTTTTGTCTCTCGCTCTA
GCACATAGACTTTCCTATACCTTGTCCACTTCGAATGTTTGAAATGCTGGTAGTTCCTGA
ACAGGATTATCCTTTAGTTTGTGTTGGCGTCGCTAGAGGAAGAGACTTCAACCAAGTGGT
TCGGTTTGAGACCGTCAACCCAAATTCTACCTCTTCCTGGTTTACAGAATCAGGTTTGTG
CCGCCTTTTCCGATGAAATCTAAGATTTGTTTATCAAATGAATGAGTAGATTCTCGAGGT
AATGAAATACTGTATGTGAATCGTAGCTAACTGGAATCCGTGTCACATTATATAGCGGAA
GCTATTTGGATATAAATCTCAGTGCTCTCTTTGAGATCTTTTCCATTTTTCTTTTTATTC
TTTTCTCGAAGAACTTCATATGCACTTTTATAGTTCTGGTGAGCATGTCATTTGTCATGA
ACGCAGCTCTGTTCCATCAGATAATAATAATAATGATAATAATTGTGGTATTTGTTAAGT
GCTAACTGTGTGCCAAACACTGTACTAACCACTGGGGTAGATACAAGTTAATGGGTTTGG
GCATAGTCTGTCCCACAGAGGGCTCACAGTCTTAATCCCCATTTTACAGATGAGGGAACC
TCCTGTTGAGATTGCACACGTGCATGTTGGAAAAACCAGAAAAATGGCTTTAGGCGCACC
TGGAGAGTTTCCAGTCCTTTACCAGTCTCAGCTAAGGGAGGGAAAGTCAAGCAGAGGCCT
ACCCATTCCATTCCTAGCTTGACAAGACAGTAATCCCTTAGTCCTTCGGGAGTGATTCAG
ACTATCACTGCAAGAGAGTGGAAAAATACTGTGCAGTTTGTCTTTTTAAAAGAGTGTCCC
AATCCTTTGCTGTAGTTCATTCATTCAGTCATATTTATTGAGCCCTTACTATGTGCAGAG
CACTGTCCTAAGCACTTGGAAAGTACAGTTCAGCAACAGAGACAATCCCTCCCCAACAAT
GGGCTCGCAGCTCTCTTCTACTCTCTTATTCCTCAGAGTCTTTGTTAAAGAACTAATTGG
ACATCTGAAACTTACTGACTCGCTGAGTTGCCACTGTATAAACTATTGGAAAGTTTTTGC
CATTTTGATTTTAGTACTTCAGTGTAGGTGACAGCCAAGCATTTACTTCACTTTAAATAT
TTCCCTTGACATATAGTGGGCAGAGAATGTCACTCTTTAATAATAATAATAATGTTGGTA
TTTGTTAAGCGCTTACTATGTGCAGAGCACTGTTCTAAGCGCTGGGGTAGACACAGGGGA
ATCAGGTTGTCCCACGTGGGGCTCACAGTCTTAATCCCCATTTTACAGATGAGGGAACTG
AGGCACAGAGAAGTTAAGTGACTTGCCCACAGTCACACAGCTGACAAGTGGCAGAGCTGG
GATTCGAACTCATGAGCCCTGACTCCAAAGCCCATGCTCTTTCCACTGCGCCACGCTGCT
TCTCTACTCTTTATTGTATTGTACTTTCCCAAGCGCTTAATACAGTGCTCTGCACAAGTA
AGCGCTTAATAAATACGACTGAATGGATTTCCCCTTTTTAATAGAATCGTTTCACTGTGA
ATATCCTTCCTAATTTTTATTCGGTTCAACTTGAAACATCCAAGCATTAAGATTCTTCCC
TCCGTCCCTCACCCCCTCCAGTTGCAATCACTTTCATTAACTTCAGTCGCCGTCATTAAT
TTCATTCTGACTCTGTGGTCGGCGCAGAGTAAGTGCTCAATAAATACCACTGATTCGGGT
TCAGGAAATTCAACCCTCCGTTGTGGCGTTTTAACTCCGATGTTAGTTCAGTCCCTTTCT
GTCCTCTGCTGACAAGAACCTGGCACTGCAACCTCAAACTTAAACTATATATGTTGGTTT
CCTAATGAACAGATTCTCACAAATGTTGCTCAAATGATCTTCCTCCCTTTTAGAAGCAAT
ATCCGTGGCTACCCTGTTGCCCATTTCAACCCTTCCTGTAGTAAGAGCACTGACCGTCTG
AATCAGAGTAGGAGATAAAGAACCGAGTGGGAATAACATTGTCTAATAATAATCATATTG
GTGTTTATTAAGTGCTTACTATGTGCCAAGCACTGGTCTAAGCACTGGGTTAGATACAGG
GTTATCAGGTTGTACCACGTGGGGCTCACAGTCTCAGTCCCCATTTTACAGACGAGGTAA
CCGAGGCATAGAGAAGTGAAGTGACTTGCCCAAGGTCACCTAGCCACAGGTGGCAGAGCC
GGGATTAGAACCCGTGACCTCCGACTCCCAAGCCGGTGTTCTTTCCACTAAGCCTGTTGC
CATCTCTCCCCAGCGTGCCCTCAAAATTCTCGATTCGAGGGAGAGGACGGTTTGTCTTAA
TAATGTTGGTATTTGTTAAGCGCTTACTCTGTGCAGAGCACTGTACTAAGCGCTGGGGTA
GATACAGGGTAATCAGGTTGTCCCTCCTGAGGCTCACAGTTTATCCCCATTTGACAGATG
AGGGAACCGAGGCACAGAGAAGTGAAGTGACTGGCCCACAGTCACACAGCTGACAAGTGG
CAGAGTCGGGAGTCGAACCCATGACCGCTGACTCCGAAGCCCAGGCTCTTTCCACTGACC
CACACTGCTTGGGACGACTCACGGAAACGTACCGACTTAAAGAGTCTTTTCCCTCTAGGC
TGTAAGCTCGTTGTGGGAAGGGAACGTGTATAAGAACTCCGTTTTACTGTGCTCTCCCAA
ACGCCCAGTACAGTGCTCTGCGCACAGTAAGCGCTCAGGAAATACCATTGATTGATTGAC
ATTTCCCTCTGGAAGCCAGAATCAGATCTCCAATAGCACATTTCTACCAGGGACTCCAAG
TCGATCCCCAAACTATGCCTGGTGATGTACGGGACATCTTAGAAATCTAGGAGAGATTTA
TTATGAAAGTGTAAACTCTTAACCAGTCTCTGAAAGAAAACTGTCATTCTTTGTGACACA
TAGGGCCGTTAACCGAGTTCATGGAAACAGTCAGAGAAATCACAGTAGATCTGTGTTACA
AGAACTGTTTTTCTGGTCTTTCTTCCTGTCTCTTCCCTCTCTTCTCCTCCCCAGCAGAGA
GTAAGTAGAAGAGCTCATAAATGCTGAAATAGTTCTGTAAGCAGGATTCCAACTTTGTTC
TTTTTCGAGGCGGGGCGGGGAATTATTTCCTTCTGTTGTTTTTTTGTTGAAGCAAAACAT
TTCATCTTCCGTAAAGGAACACTGAAGTGTCAAGAACATTTTGATCGCAGTGCCACCGAG
ACCGCAATGAGTATCGTGAGGATGGCAAAACATATCCATCTTCCGCAGAACTACTGCCGT
TAGAGTTGAAGCCATTTGTCCGTGACTCCGATCCGAAAATCCGTAGAGATTTAAAATGTA
AAACAGATGGGTTCTGTGTGCTAAACTGTGTAAATTATACTGTGTATATGGTGCCTGTTG
ATTGAGTCTACATATAATTTCCCCCAGTCTGTTCAACCCACTTTTTTTTAGTTGTGAAAC
TTAGGTTGGCCTCATGAGTTACCGAATATTTTCCCTGCTAGAAAACTCACAGAGGAGACA
CGGCTTTTTTTGGCACGTACGTGGCATCTTTAGAGAGAAGCAACACGGTCTCGTGGATAG
AGCGCAGGCCTGGGAGTCAGGAGGATCTGGGTTCTAATCCCGGCTCCGCCACTTGTCTGC
TGTGTGACCTAGTCACGGTTTCTCTGTGCCTGTTACCTCATCTGTAAAACGGGGATTAAG
ATGGTGAGCCCCACGGCGGACAGGGACTGTGTCCAAACTGATTATTTTGTATCTTTCCCA
GTGGCTAGAGTGCCTGACCCATGGTAATCGCTCAACAAAGTCCATTTAAAAAAAAATCAC
TTTGGGGGGGCAACACTTAGCGGCTCCAGAGGGACTTGTGTCCAACTTCACTAGAAGAGG
GAAAAATGAAAATAAAATTTAGAAAGGATACGGTGATTCCTGAACTATCTCCACTTTGGG
ATAAAAAAAATAGTAAAACATTATGTTGTGTCCTTTTTTAAAGTAATAGCTTTAAAATAT
AACTATTAGTGGAAATATAAATCACAGTGACATGTTGGGGAGGGGAGTGAATGATTTCCC
AGGGACTTGTTGCAGCACAGCACAGTGCTTGGCACACAGTGTCTAACAGATGCCACCGTT
GTTGTCCTTAAATGTATTATTAGGGAATAAATAGAATTTAGGAATAACTGGTATCATATC
CAGTAAGACACCTTTTTATGCTATATCCTGATGAGAAATTTAAAAATCTGACTGGTTTCC
AGGGTGATTTATTTTCAGGGCTTTCATTTGCCATTTAGCATTTTATTTCTCATACCATCA
CTGTGATTCAATTTTAAAAGGATTACTAACATAGCTGATTTTTTTGAGCGGGGAGGGGTT
CTGATTTTGATGATCCTGGGATAAAGAAAAAAGGATGCTTGTTGGTAGCTTGAAATTCAT
GATCATTAGATATACTTTCATTTTTATTTTCACATCTTTTATAGACACAGTCTCCCTATA
GCACAGGGAGAAATAGCTGCAAAATCCATCCCCGAGGATGAGATTTGGGGCCACTAGAAA
ATGCATGTTACAAATGTCTAGTTGAATGTCTACGTTCCTTTCAATTAGGATAATATCAAA
ATCGCCAAATTCGAAAGAAATCACCACTTTAAAATGTAATTGCGATCATTATGTTTTATT
TTAGACACCCCACAGACCAATGTTATACATGTAACCCAACTGGAGAGAGACACAATCCTT
GTGTGTTTGGATTGTAAGTATTTAGTGATAGTCCTAATGTTTTAATGAATAAATGTTTTC
TTTTAATTATTGAGTGATCTATTTTGTTCTCTAGGCTGCATAAAAATAGTTAATCTACAA
GGCAGATTAAAATCCAGCAGGAAATTGTCATCGGAACTCACCTTTGATTTCCAGATTGAG
TCGATAGGTATGTAAAAGTTTTGATCCTAATGTCTCCTGATAAACTCATTTACTGTTACC
ACAATTAAAGTCAGTATAAAGATCGACTACTTGGTAATTTTTTTCTGGTAATTGATGAAA
TTGCATTTTTGCCTGTTTCAAAGTATTATATCAAATTGGACTAAGAAGTGGAGTAGATGC
TGACATAAGGGTCAGGAATGTGCTGCAGTCTCTGAAATTCCTCTGATTTATTCAATATGG
GATGAATAATAATAATAATGGTATTTAAGCGCTCGGTATGTGTTAAGCATGGTATTAAGC
GCTGGGATAGATACAAGGTTATCAAGTTGGACACAGTCCCTGTCCCAAATAGGGCTCACA
GTCTGAGTAGGATTTAATCCTCTTTCCAGGTGAGGGAACTGAGGCACAGAGAAGTTAAGT
GATCTGTCCAAGGTCACACAGCAGACAAGTGGCAGCGTCCAACCTAATTTACGTGTACAT
ACTGTAGTGCTTAGAACAGTGCTTGACAATAATTGTGGCATTTAAGCATTTACTATGAGC
CGAGCACTCTACTAAGCCCTGGAGAAGGTAGAAAATAATCAGGTCCCAAGTAGGAGGGAG
AACAGGTGTCGAGACCCCATTTTGCGGGTGAGGGACTTGAGGCACAGAGAAGCGACGTGA
CTTGCTCAGGGTCACTCAGCAGGCAAGAGATTAGAACCCACGTCCTCTTAGCTCCCAGGC
CTGGGCTTAAGCCGTTAAGCCACGCCACTTTGCAAATACCATTAGAAAAGCAAATTCCAC
TGAAAAGAAAAAGCAGGTACAAAGGGGCATTCCGAGGAGGAGAAATAGGTCGCGTAAATG
GCAGTTAGGGATTAGAAGGGTATTGCTGCAAGTCGAGCCAACCGAACAAGGAATCTGTGG
TGAGCCAGGTCGACTTGATTCCTGTATTTGTTCCGAGTCGTTGAATCTGTGACTTGAAGT
CCGTGGTAGGGGATGGAGAGCAGGCTCTGGGAGAGGGGTTTGGTGACAAGATGGAGTCCA
AAAGAGCACACATTTTAGGAGTCAGTGACCTGGAAGTTGGAGCGTCTCTCGATGACACCA
TCCGAGATGTCGTAGTTCCTGGGTCACTGTCTTGGGGAGAAGTAGGTGGCCCCATTCCCA
GGGAGAGGGACGAACTGTGGGACAGAAGGCTGGAAGTGACCGAGAATTAAGACGGGAGAG
TGGATAAAGAGAAAAGCCATGACCCCTAGTCAGTGGCCTGGAAAGAAGGAGGTGAGTTTA
GCAGGTTGGGGTAACGGGAGTTGAAGAGTCATAGCACGATATTACAGAACTGTGACTACG
GGATAATGACCTTGCTTTCTCCCTCCTACGAAGATGAGTTACACCGGCGGTATACCCTTC
TCAGTCCATAAAAACGAGTAAATTATTCAAAGGAAGCCAGTGGCCGATTAAAATTCTACC
TTCGGTGATAGCGAAAAGGTGATTAAGAGATGCTTCTCAATCGGATAATAATTCGCCTCA
TTTCTTGCCTACCAGTTTGCCTACAAGACAGCGTTTTAGCATTTTGGAAACACGGGATGC
AAGGGAGAAGTTTTAGATCAAACGAGGTAAGCGACGGTTCAAAATTAAACTTAAACGGTG
AAAGGAATGTTTTGAAAATACTTGATTTTCACATGGCACGGTGGGAAGGTCAAGAATTCT
TCAGTTATTAATTCAGCTGGGAAGAATGAGCAGCTCCCCAGTTGATTCACTTTTGCAGTT
AAGCAACTGTCCATGGACCCCCTGCGAATGGATTAGCCGTGGCCCTTGGAGGAGAGGTCA
TCTCTAGGTTCTGAGCTCGTCGTGGGCAAGGGATGTGTCTGTTTAATTGTTCTATTGTAA
TAATAATAATAATGGTGGTGTCTGTTAAGCGCTTACCGTGTGCCGGGCACTGTACTAACC
ACTGGGGTGGATACAAGCAAATTGGGCTGGACACAGTCCCTGCCCCACATGGGGTTCAGA
GTCTCAATCCCCATTTTACAGACGAGGTCGCTGAGGCCCAGAGAAGCGAAGGGACTTGCC
CCGGGTCCCACAACAGACAGGTGGCGGAGTCGGGATTTGAACTCATGACCTCCTGACTCC
CAGGCCGTGCTCTATCCTCTAGGCCACGGTGTCCTCTCCCAAGTGCTCAGTCCAGTGCTC
TGCACACAGTAAGCACTCAATAAACTGACTGGCCGAGGGAAGGGGGAATGGAATCCACTC
AATGAGAAGCGGAACCTGAAACGATCGGCATTTATGTAGGTTTTATAGGTGTATGTAAAA
TACACCAGGAAATGGTGATGTGGTCTAGGGAGCTCAAAAGCGTTTTGTGCTGCTTCAGGA
AGATTCGTGAAAATGTAGTAGTAATATTTAAATGGTAGAGACAAGAGTTAAGGTCTAGCA
CAGCTGGGGAATTTTTTTTTCTAACAGAATTGTCCGACCCCTGAAGACTTGCACCAGACA
CACCCGTCACGAAGGCACTTTGTGCCTAACGATAATGATAATAATAATGGTACTTTTTAA
GCGCTTACTATGCACCAAGCACCGTTAGTGATATAAGGTAATAGATACAAGCTAATCAGG
TTGGATACAGTCCCTGTTGCACATGGGGCTCTTATTCTTAATCCCCATTTTAAAGAATGA
GGTAACTGAGGCCCAGATAAACTAAATAATAATAATTATTGTTATGGTATGTGTTAAGCG
CTTACTATGTGTCAAGCACCGTTCTAAGCGCTGGGGTAGATATCAGGTTGTCCCATGTGG
GGCTCCCGGTCTTCGTCCCTATTTTACAGATGAGGTAACTGAGGCCCAGAGAAGTGACGT
GACTTGCCCAAGGTCACAGCAGACACGTGGCAGAGCCGGGATTAGAATCCAGGTCCTTCT
GACTCCCAGGCTTGTGCTCCGTCCACTGTACCACACTGCTTCTTAGGGAAGGCTAAGGAA
AATACCATTTGTACAGTAATAAGCTCTCTGGATCCACGGCCAGAACGATTGCAGGTGGAG
AGCGGGGCGCTCTGGGAGAGATGTGTCCGGGGGGTCGCTACGGGTCAGAGACGACTCGAC
GGTGTAAGACGAGACGAGACCTGATCACTCTGAGTGTACAGATATCAAAAATTGTCCCAA
GAAACAGAAAACCCCCCAAAAGCCACACCAAAAAAATCCCTCCTCCTATGGCACCGGGCT
CAAAATGAGGAGGCCTCCTTTTCCGTGGACCAGGATTCACTCATTCGTTCATTCAGTCGA
ATTTATTGAGCGCTTCCTTTGTGCAGAGCACTGTACCGAGCGCTTGGAATGCACAGTTCG
GCAACAGATAGAGACAATCCCTGCCCAACGACGGGCTCACAGTCTAAACGGGGGATTCTT
AAGGGCACTGACCACTGTCCTGAGCCGACCACAGCCCAGCCATCAACCCTGCCCATACCC
TCCCTCTCCCCCGCGGACCCCAGCTTAGCTCTCATTCCCGCCCAGAGGAGCTGACGGATG
TTTCGGATCGTCAGTCATTTTGATGAAGTGTCCCGGGATCCCAGAAGCAGTTCCTCCAGG
CCCTGTTAGACCTGCTGTGTTCCCTCTGGCCAGAGGATGCTATCGGGACAAGTCAAGGCG
ACGTAAATTTAAAAGTCAAGTGAATTGATTTAACGTGTTTTATAGTTAACGACCTGTTTT
TGCCGTGGATTTTTTGACCACGATGGGCATCTCGTCAAGTTGTGGAATCCCCTTGTCAGC
GGCAGTAAGGTCAAAGCCCAAGGACAGCGGTATTCTTGAAAGAGAACGTATCCCTGAAAA
GAAAAATATATATCTAGCGCTTGAAAAGTCTAATCCGCAAAATTTTATTTACAGCTTCCA
AAGTGCTTAGCACAGTGCTTGACATTTTGTGCGGTTGTTTCATTTTGTGCGATTGTTTTA
TACTTAGAAGGCTGCAGCCTTTTGACAGATTGGATTATCTGATGTCATGAAAGTATTTCA
AACTCGAAGGCCACTAACCCTCAATACCATTTCTGTTGACTCTAGTGTTTGTTATATTTA
TTCCAAAAGAAACGTTTTTCTTATGGTAGTGTACAGTAAAAGACAATCTTACTTAAATTT
TAGGCAGATAAGAGTACTCTAGAAATTCTTCATAGGTATATTAAGAAATGTCCATTACTT
TTCTTCATGAACTAACGTTTGTTTCATTAAATTAACTCGTACTCTATTTCCATTTTCATT
TTGAGCATATAGTCTCCTAGATGACCAAATATTGTGCTCTTTTAAGGCAGTCCTCTTTTC
CATCATCTTTAATTTTTTAGTATCTAGTTTGCTTCATCCAGAAAGACTTGTAGGTAATAT
TCTGTTTCCTACACCTGTAGGAGACAGATGTCCTTTAATAAGCGCTTTCCTTCCTTTTCA
CAAACCCCTTTGTAAATGTTCCACATAACTGTTTTCTAAGTTGCTCTGGTTTATTTCTTG
AATGGCCTGTGAACCAAACATGGTACCTTCAAATTTCCTAATTCCAATACTCTCTTGGGT
CTGTTGTTTAGGAAGTAAATGAGGTTTTCCCTGTTCCCACAGTGCATGAAAATTCAAATA
CATCCATTGCCAGATTTACTGAGATACTTTGACTTAGCGACATCAAAGAAATTAAACCCA
GAAGGCTATGAATTTTGATCTTTTTCTTAAGAGTTAAATTATAAATGGAACACATCAATT
TAAAGCCGTATTCTTTTTTTTTTTGTATTTAACAGATAACCCAAGAAATTTCTGATAGTA
CAAGGATATTCAGGCTTCTTGGATCTGACAGGTATGACTAAATCGGGCCTGGGCATACTA
TTTTAAAATGTGTGAGGAATATTTCTTTCTCATCAGAACTAAGCAGCGTGGCGCAGTGGA
AAGAGCACGGGCTTTGGAGTCAGGGCTCATGAACTGAATAGAGACTGTTCAATTTTCTAT
TTTTCGTATTTCTTATCCAGTAAGCATGCCAAATCCAGCGAGCTCATTATGGGCAGGAAA
CGTGTCTAACAACCGCTGTACTCTCCCAAGCATTTAGTATAGTGCTCTGCACACAGTAGA
TGCTCAATAATTACGATGGATTGAAACCAGAAACCTTTGAGAGCCAAAGGGAAAATGAAC
ATGAACCTCTTTAGACTCTAAGCTTCTGCTTACTATATGCCAGGCACTATGCGAAGTGCT
GGATTGGACACGATACACATGTTCTACATAATAAGAATGATGGCATTTGTTAAGCGCTTA
CTATGTGCAAAGCACTGTTCTAAGCGCTGGGGGGGGGATACAAGGTGATCAGGTGGTCCA
ACGTGGGGCTCACAGTCTCAGTCCCCATTTTCCAGATGAGGGCACTGAGGCCCAGAGAAG
TGAAGTGACTTGCCCAAAGTCACACAGCCGACAAGCGGCGGAGCCGGTATTAGAACCCAT
GACCTCTGACTCCCAAGCCGGGGCTCTTCTCACTGAACCGCCCTGGAGCTCGCAGTCTCA
TTACCCATTTTACAGATGAGGCAACCGAGGCTGAGAGAAGTGAAGCCACTTGTCCCTAGT
CCCAAAGCAGACGAGTGGCGGAACCTGGGATTGGAACCCAGCTCCTTGTGGGAAGGCAGC
GGGTCTCCCGGCTCTGTTGTATTGTACTCTCCCAGATGCTTAGTGTAGTGCTCTGCACAC
AGTGAGCACTCAGTAAACACCACTGATTGATGTTGTCTATGTTGTGAGAAGCAGCGTGGC
TCAGTGGAAAGAGCCTGGGCTTGGGAGTCAGAGATCATGGGTTCGAATCCTGGCTCTGCC
ACTTGGCAGCTATGTGACTGTGGGCAAGTCATTTCCCTTCTCGGTGCCTCAGTGACCTCA
TCTATAAAATGGGGATGAAGACTGTGAACCTCACCTGGGACCACCTGTTGACCCCGTATC
TCCCCCGGCGCTTAGAACAGTGGTCGGCACATAGTAAGCGCTTAACAAATACCAACATTT
TTTGGTCTGCCAACTTGGTAGAGGGCAGTCTTATCGGAGGAAAAGATCGCCCTGCCTCTA
CCGCAAAAACAGGTCGTTCTTTTTAGAAGCATCTGCTTTCTACCTTGAGGAGGCTTTCTA
GTTTTGTACAGCTGCGTTTATGACAGACGTGAAGAACCAGCATCTGTGAACAAACGAAAA
TGACTTTCCCCCAGCATTTTTGAGGAGAGACTGAGAGGTGGGCCGGGTTGGACTTGTGAA
TCCCGGTGCTTTAAAATCCTAGTGCCGAAAAATCCATTCCAGCCCCGGAACCTGGAGAGC
CGTTATCGCGGAGGGAGGTTAAAAAGAGAAAGACTCTGTAGTAAAAGTGTTTCCCACCAG
CCTCCTCTTTCACAGATGCTTTTCAAAAGATTATTAGACTGAGAGCCCGTCCTTGGGCGG
GGATCGTCTCTATCTGTGGCCGAATTGTCCGTTCCAAGCGCTTAGTATAGTGCTCTGCAC
ATAGTGAGCGCTCAGTAAATCCGATTGAATGAACGAAAAGATGAAAATGTTTTGTTTTCT
TCTTTTGCTTCGCAGGGTTGTGGTTTTGGAAAGCAGGCCAACCGATAATCCTACAGCGAA
TAGCAATTTGTACATCCTGGCGGGTCATGAAAACAGTTACTGAGAAATCCTGTGCCTGAC
CCAACCGGAGCAAGAGGGGAAAACACTATTGTTCAACAAAACCGGATGCTTGAAGTTGTA
CAAAAAAACACAGAAAGTGCAGGAACCTGGCTTCAGTTACTCTCTAATTTATTGGGGCAC
GAGAGAAAGATGAGGAAGAATTTTGTTCTTAAGCGGTACGGACGTCCACACCTGCTCGTC
CACGCCGAGGGCCTCGTTCACCGTTATGTAATCTTTGTACATAGAGGCGGTGGTTTTCAG
TGGAATTTCGTCTCGCCGAAGACCTACACTAAGAGTTTCTGTAGATAGTGGTCCTTTTAT
GATTTAAACGTCTTATCTGTACAGATGTAAAGGTCGTGGATGCAGAAATGCATTTGGGGG
TACTCTTTTAAGAACCGGGGTGGGGGGGATATTCTCGGGTGCGGCTATATTATCAAACGA
GATGCTGGCAGGGGGACCCGGCGCATTTAACAACACTATCGTATTTTTATTATCTGTAAT
TTAGTATGACAGATATAAATCTTGTAACTTTTAAAATTGTAATCGAGGCTGTAATCATTT
TATAATCCTGTTTTTAATTTTAATGCAAGTACACTGGTGTTTATATTTGCACAGAGTATT
GACCTGTGATGTATTTAGTCACCAAGGTAAGCTGTGACGTCGTTGAAACGCATTGGGCTT
GAAAATACCTTTCTAGAGTCGATCCGGCTGGGTTTCGCGGTGAAACCAACCACCCGCCCA
CCTGTTGTAGTAACTGGTCCTTTCTGAATTTAAGCCAAATTCTGTGAGATCGCTTCTCTG
TGCTCAAAGACGATACCTTCCGGAATGATTTGGAATCACAGGGAAAGGGTGCTGTGAGGT
AACCGCAGTTGTCGTTTCAATTATTTCGATTATGTGCATCGATCAAATTAGCATTATGGA
GAGTCCACAATAAACATTTCATGTACTCACAGTGAGGAACTGTTAACATTCCCTCGAGTG
AAGTGGTTCAAATTCCCAGTTGCATGGTGACTCTTTTGGCCTTTTATAATTTTCATATTT
GTTTTGATTTCGGGTGTTAACGTGTGGCCAAAATAATTTAGTTACTACCTCATGCAAACA
ATATAATGGTTACTACACATCACGGGAACTTAGTTTTGGTCAAAGGTCATTTTGATTGCT
ATTTTCCGATGGCGTATGTAGATACCGAGTTTTAGCGAAATGCACACTTTTGGCTCCTTT
TTTGTATATGTTCTTTCTATTTTATTGTGAGTATATACACTAAGAAGAAACTAAATGGTG
ATTTATGGTCCCTCATTACTTATGTGCTTGGAAATGATTTTGGATATGTCTCTGTACATA
GTGTAAAATAAACATGTTTTTTAACATGCCGTTGTATAGTAGCTTGCCCCCTGCATTCAT
TTCTGCACACACTTCCTCCTCTAATAATCCTAATGTTGGTATTTGTTAAGCGCTTACTAT
GTGCAGGGCACTGTTCTAAGCGCTGGGGTCGATGCAGGGTGATCAGGTTGTCACCCGTGA
GGCTCACGGTCTTCATCCCCATTTTGCAGATGAGGTCACTGCGGCCCAGAGAAGTGAAGT
GACTGGCCCACAGTCACACAGCTGACAAGTGGAAGAGCCGGCATTTGAACCCGTGACCTC
TGACTCCCAAACCCGGGCTCTTGCCACTGAGCCACGCTGCTTCTCTGCTCCTCTAGACTG
TAAGCTCCTGGCGGGCAGGGAATGTGTCTTCCAGCTCAACTCGGTTCAGTTCAGATGTAT
TTATTGAGCGCTTACTGCGTGCGGAGCACTGTATTCGGTGCTTGGGAGAGTACGGCACAA
CAATAAAGAGACGCGTTCCCTGCCCACCAGGAGCTTCCAGTCTGGAGCGGGGACACAGAC
GTCAATACAGATAAAATGACGGACAAAAGGACGTAAGCGCTGTGGGGCTGGGAGAGGGGG
GAAGAGCAAAGGGAGCGAGTCAGGGTGACGCAAAAGGGAGAGGGAGATGAGGAAAGGGAG
GGCTTGGTCTGGGAAGGCCTCTCGGAGGAGGTGGGCCTTCAGTACGGCTTTGAAGGCGGC
AGGGAGAGTCATGGTAGATTTGAGGAGGGAGGGCGGTCCAGGCCGGAGGCAGGACGTGGG
CCAGGGGTCGGCGACGAGACAGGCGAGGTGGAGCCCCCGTGAGAAGGTTAGCGGCGCCGG
AGGAGCGGAGTGTGCGGGCCGGGATGGAGAGGAGAGAAGCGACGTGACGGAGGGCTTCAA
AGCCAGTGATGGCGTTCTTGTTCGATACGGAGGCGGATGGCCAACCGCTTGGAGTTTGGG
GGCGGAGCGGGGTGACACGTCCTGAACGTTTTTGTCCAAAAAAGATCCGGGCAGCAGAGT
GAAATATGCCCTGGAGTGGGGAGAGGCAGGAGGCGGGGAGGTCAGCCGGGAGGCCGATGC
GGTGGTCCGGGCCCTGAGAAGTGACTCGCGCGAGGTCAGTCCCACGGTAGGCAGGTTATT
ATCCGTGATTTAGTAGGACAGGTGTGAATCGTGCAACTTTTCAAATGGTAATTGAGGCGG
TAATCATTTGATAATCCTGTTTTTAATTTGAACGCAAGTACACCGGTGTCCCATCGGTAC
CGTCAGTAAATAGGATGGATGGGGCGGAGAGCGCAGGCTGCCACTGGAAGAGTGAAGCGT
GTTCGCTGGGCTGTCGTAGGAGATCGGTAAGGTAGGAGGAGATAAACCGATAAGGAGTTT
GACGCGGAGGTGGATGGGCAACCGTCGGGGGTTCTGGAGTGGGGGGGATTATGCTCTCCC
GAGTGCTCAGCACAGTGCTGTGAACATAGTGCTCAATAAATACCATTTTGGGTTCCTGGG
GAGAGTGAAGTAAATTTCTTTTTAGAAAAATCCGGGCAGCAGAACGAGGTACGGACTGGG
GTGGCGAGAGACGAGAGGAAAGGAGATCGGTAAAGGGGCAGATGGGGGAGTCAAGGATCA
TTTAAATCGGGGTCGGAGTTTCCTCCGCTCCCCGTCGCCCCATCACCCCAAATCGCTCCC
CTTGCTCTACTCCCCGCCCCACAACGTTTGGGATGTATACATGTGCATATTTATAATTCT
ATTTTTATTAATGATGCGTATATATCTATAATTCTATTTATAATGATGCTGCTCGTGCCT
GTTGACTCGTTCCGATGGCGGTCTCCCCCGTTCCAGACCGTGAGCCTGTTGAGGGCAGGG
ATTGTCTCTGTCTGTCGCTGAATTGTACATCCCAAGCGCTTAGTACACTGCCGTGCACAC
GGTGAGCGCTCAATAAATACGATTGATTGAATGAATGAATGAATGCGTGATGGAGAGGAA
AAAGTGGATTTTAGTTATGTTGGGAAGGTGGAACCAACAGGATTTGGTGGCAAACTGAAT
ATGAACATGCATACGACTATAAATTCGTCAGAGGTGTTTATTGAGAGCTATGTGCTGTAC
TAAGCGCTTTAATAATGATATTCAATCGTAATAGTAATGATACTAATGTTGGTATTTGTT
AAAGCGCTTACTCTGTGCAGAGCACCGTTCTAACCGCTGGGGTAGATACAGGGTCATCAG
GTTGTCACACGTGAGGCTCACAGTCTGAATCCCCATTTTGCAGATGAGGTCACTGAGGCC
CAGAGAAGTGAAGTGACTCGCCCCAAGTCACCGAGCTGCCAAGTGGCAGAGCCTGGATTC
GAACCCATGACCTCTGACTCCCAAGTCCGGGCTCTTGCCACCGAGCCTCGCTGCTTCTCT
AGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1317..1488, 7684..7752, 7834..7926, 9435..9505, 12635..12690, 14415..15917
1317..1488, 7684..7752, 7834..7926, 9435..9505, 12635..12690, 14415..14502
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved