Ornithorhynchus_anatinus Locus Mono:snopsi28S-3327
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:snopsi28S-3327
Ornithorhynchus_anatinus
Mono:snopsi28S-3327
Contig5216
snopsi28S-3327
1001..1138
2138
ACACATAGAAACTTATACATCCAGTCAGATTTTATTCTAAACTCTTCAAGAGAAGGGAT
TTGGATTTATTTTTCTGTTTCTCTTTAGTGCCTACTACAGGGCTCTGCACATAAAAACAG
TTCAGTGAATACTGAGAACATTGACTACGTTGAATAGCGATGTAATGGGAAAATGATGGG
TGCTTTAGAAAATATCCAACTCTTTCTGATCATGGGATGGTCTTCTTTAAGTTGAATAGA
CAGTTTTGATAAGCTTGGAAGTTATTGAGGTCACTGGACCAAAGGATACCCCTTAGCTCC
TTTCAGATCTATGATACTGTGAATTGAATTGCCCTTATTTTCTGATTGTCCATCCTGTAA
TATGGCCAAAACCTAGGCAACCTTTCTATAGTCAGGCAAAACCTGAGTAATATTATGCAT
TTTTCAAAGCAGAATAGGATAGTAGCAAAATTGTTGCCATGGTCCCTGGATATTTTACAA
ATTTTGCAATTCACTTGACCTATGGAGGAATAGCATTAGCAAGATTCCAAAAGAACCCTT
AATTGAAATATAAGATATTGCAGCAATCTACCTTACATCTATTTGAGAAACAAAATAGGG
AGTCTGTAAATTTCATTATTTACAATTTGTCTAGCAGTAGAAAAGTATAATATGGCATAT
CAATATTGGTGCACAGGTCTGGGAGAATTAGGTCAAATCCAAGAGCCATTTTAAACCCAT
AAGATAGGAATTTAAAGAAAAAATACCCTAAACATTTGGGATCCAGTGGTTTATTCTTAG
CAAAGCACAACCTCTTAGGCTTATGGGAGGGGAGGTGGGGTGATAGAAAAGGCTTTTAGG
AACTCACTTTAAAAGCTCAAAAGGTGTCTGGGACACTGTGCCATTGTTAAAAGCTCTAGA
TAGATAATTTCAATATAAATGAACCCGTACTCTATGGATTAAATTTGCCTTAAAATATCA
CAGCCTGAAAAATTAGGAGAGGAGTACTTGAGACAAACACAATTTGGCTTTTATCAAACC
CCAAATGTTTTAAAAATAATTTAAGAGGGGCTCAGTGAAAGCCCAATGCAACCAGGTTCA
GCTGTCTCTGATCTGTCCATTAAAAGCTGCAATTCTGTAATAATTATACCTGCATTGAAA
TGTGTGATTTATACACATGCACTCAATAGTATGCATTTAGCATAAGCTTTTGAGAGCTAT
TTTCCCCAGTAAACATAAATGTGTGTGCTTTATTGAGAATAAATTCAGTCGAATATCAAG
AGTTTGAGGGGTTCTGAACCCATTAATTTGGAGAGGCTTTTAAATGTAAAAGCTGGTTTC
CTATTTCATTATAGCTGTTGCATTGGTTTAATAGGCATCTTTTTAGCAACTTTTCCCCAA
CAGATTGAAAAGACTGTTGGTAGACTCGATAAAATATACCTGAAATGTGCAACACAGCCA
CCTCTTGGGGGAGATAGGATAGAGGTTGAACAATATTGCAACTAACCTCTGTTTCACATT
TCCCTGAGAGAGCTCTGTCCGCCTTACTTGCTGCATTCAACATAAGAACGGAGATCCGAG
AGGGCACTGTTATTTCAAGCCTCCATTGCCAACTAATAGAAATAGTGCTCTGATCCAGTA
ATGACATTCATAATATTCATATTAATAATAATAATAATCATGGCATTTAACTGATTACTA
TGTGCCAGGCACTGTTCTAAGCACTGGGGTATATGCAAGGTAATCAGGTTGGACACAGTC
CCTGTCCCACATGGGGCTCGCAGTCTTAATCCTTGTTTTACAGATGAGGTAACTGAAGTG
CAGAGAAGTGAAGCAACAGTCCCAAGATCACACAGCAGACATGGCAGAGCCAGGATTAGA
ACCCATGACTTTCTAACTCCCAGGCCCATGCTCTATCCACTACACCATGCTGGTTCTCTA
AACCATGCTCCTTCTCTAAGCCATGCTGCTTCTCTCTGCCGTGCTACTTCTCTATTAATG
AGATACATGTGCTTAAAGGTAAGAATCTGAACCTGGAAGCTTTTTTTTAATGATATTAAA
GTGCTTACTATGTGCTAGGAAGATAAAAGATAATTGGGTTGGATACAGTCCCTGTCCCAC
TTAGGGCTCACAGTCTTAATTTCCATTTTACAGATAAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved