Ornithorhynchus_anatinus Locus Mono:SNORA7
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SNORA7
Ornithorhynchus_anatinus
Mono:SNORA7
Contig51545
SNORA7
844..981
1981
GGGCTCCTGTTTCCGGATCTGCAGCAGTGTGGCATAGTGGAAAGAGCACAGGTCTAGGA
GTTATAGGACCTGCGTTCTAATCCTGCCTCTGCCACTTGTCAGCCATGTGACTTTGGATA
AGTTATTTCACTTCTTCGTGCCTCAGTTTCTTCATCTGAAAAATGGGGATTCAATACCTG
TTCTCCCTTCTATTTAGACGGAGACCCCCATATGGGACTTAATTATCAGTGCTTAGTACA
GTGCTTGGCACATGGTAAGTGCTTTACAAATACCCCTATTATTATCATCTTGACAGTTTC
CTTATGTCAATCATCACCAGGGAAGCTGAAAACCCAAAGCAGCAACAGAAGGTTTTCAAA
AGCTGTTTCTATTAGACTGTAAACTACTTGGGGGCAGGGATCATGTCTACTCATTCTGTC
TTACGCTCCTAATCGTTTAGGTCAGTGCTCCCAACACAGGTAGGAGCTCAGTAAATACCA
TCAATTTTCTGCACCGCCTTCACATAGCCACAGACAATCACTATGAGAAGCGGCGTAGCC
GAGTGGAAAGAGCTCAGGCCTGTGAGTCAGAGGAATTGGATTCTAATCCCGCCTCTGCCA
ACTGCTTGCTGTGCGACCTTGGGCAAGACACTTTATTTATCTGTGCCTTGGTTTCCTCAT
CTGTAAAAAGGGAATTTGATACCTGTTCTCCTGCCTACTTAGACTGTGAGCCCCTTGTGA
GACAGGGGCCATGTCCAGCCTGATTATCTTGTATCTATTCCAGTGCTAAGAACAGTCCTT
GATAGTGCCTAACAAATGCTACAATAATAATAATACTAACAGTAATGATCACTAGATTGT
AACACCCCTCTCAGGATCGCCCCTGGAGAGTTTCCATTACTCCACCACTCTTGATTACGG
GAGGGAGAGTCAAGCAGAGGCCTACCCATTCCATTCCTACCTCGGGTAGTGGCTAACAAG
TGGAAGTCAAAACTCACCTGGGCTGGGCAGCAGTGGCGTGGGAGAGAGTCGAGGGCCGAG
ACTCAAGTTTACTGAGCAGGAGAGGGCAATGGTAAACCACTTCCATTTTTTACCAAGAAA
ACTCAGTGGATACACTACCTGAGCGACTGCAGGTGGAGAGTGAGGTGTTCCGGGAGAGGT
GTGTCCATGGAGTTGCTATGGGTCAGAGATGACTTGACAGCATAAGACAAGACAAGATTG
GAATATCCTCAAGGGAGATATAGTAGGACCTAACTTCTAATCACAACTCTGCCACTTCTC
TGCTGAATGACCTTGCATGGCCTAGTGGAGAGAGCAATGGGAGTCAGAGGACCTGGGTTC
TAATCCTGGCCCCGCCACTTGTTAGCTCCACCACCTTGGGCAAGTCACTAACTTTTCTGT
GCCTCAGTTACCTTCCCTGTAAAATGGGGTTTAAGATTGTGAGCCCCAGCTGGGGCAGGG
ACAGTGCCCAACTCGATTTGCTTGTATTCAACCCAGCGCTTAGTACAGTGCCTGGCACGT
AGTATGTGCTTAACAAACACCATTATTAGTATTATTAAGGTACTTAGCTTCTCTGTGTTT
CAATTGCCTCCGCTGTAAAACGGGATTAAGACTGTGAGCTCCACACGGGACCGGGACTGT
GTCCCACCGGACTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved