Ornithorhynchus_anatinus Locus Mono:SNORA55
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SNORA55
Ornithorhynchus_anatinus
Mono:SNORA55
Contig49400
SNORA55
1001..1140
1588
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNGGAACTCAGCTGATTAAACTTGTATCTACTCCCAGTGCTTAGAATC
ATGATCAACATGTAGTAAGGGCTTAAATGGCATGATTATAGATGCAGAACAGTAGGATGA
GGTGGGTCAGTGGTCTTGTGTATGTCCTGAAATACCCATGCCCACCCCCCCCGGTCTGGT
ATGAAAGGTAGTCTAGGCAGGTTTTTGAGCCAAGAAGACCAGAGGGAGTTCCTCTGGGCA
TCAGTCTGCCCTGTCAAAAATCAGTCTCAGGTGAACTTATTGCTGTTTCCCAAAAATAGG
AAATGGGCATGGACCACTGCAGACGGTCTGTCTGGATTTAGTTTTTAGGTTATCCCTTCG
GGTAAACTGTTCATTGTGAATTTATCATTAGCCATTTTGCCCTTGACCATGTTAACATCT
GCCTTTCCGAAAACCAGTCCATACCAGTTGCCCGTTTTGTGACCGGGCAGTGAACGGAAT
CTATGAAAAAGCCATTGGGTTTCTTTTGCCTGCTTCATCAATCTTTTCTGGCACCTCAAC
TTCTCTCCCACCACTGGCTGCAATGGCAAAACTGAGACCTCCTTCACGACTCATGCTTCT
GCCTCGATCTCCCCCCCCCCCCGCAGGCTTCCAAGGAATGCCAAACGCCATGCGCCAGTC
TGGGCCTCGCCCAGCCCTGCGCCACCTGACCCCAGCGGGTAACGCTCAGGCCTCTCGCGG
CCTCCCGGCTGCTCCCCAGAGAGTTGGTAAGTGGCGTCCTTCTGGGAAGTGACATTTTTC
TCCCCAAAGAGGAATTTGCGAAGGATTGAAGCCAGGGCGGGATCTTCTTCTCACTGTCCC
GCTGGCGGCTGGTCGGGCTCGAAGCCGGCTGGGGTACAATTGCGTTGGATTGTTTCCGCC
CTCTACCGTGACGTGAGAGTCTTAGGATGGGAGATGTTACAGAACCAGCAGGGGAAATCC
AGATGGGTGATCTTCCACCAGAGATAGAGATAGCCCTCATCTCTACACCTCTGCCATAAC
TCTTGGGTCCTGAGAGTTTGAGGGGCACAGCGCAATATATTACACTTTTCAGTTCCGCTG
CAGTCAGGCCATTTGGCTGTGAGTCGGATAAACTCTCCCCCTTATTGGGGAGTAGTGCTA
CTTGTTGTCTGATCAGCTGGGCATCTCTTCACCTGGAGAGCTGAGTTGGAGTGCAGATGA
CCTGGGTTCTAATCCTGCCTCCCCCACCTCGGCTTTGTGACCTTGGTCAAGTCACTTCAC
TTTCCTGCCCCCTTTTCCTCTTCTGTAAAATAGGGATAAACGGGTGAGCCCCATGTGGGA
CAGGGGGACCGTGTCCATACTGATTAACTTGTATCTATCCCATCACTTAACTATTACCGT
TATTATCGTCATCATCAAATGAGGTGCACCGGCACTGGCTTCCCGCAGGGCTCGCAGAAG
CTCCCGTCTGTTTCTCTTTCCAAGGGTTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved