Ornithorhynchus_anatinus Locus Mono:SNORD111
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SNORD111
Ornithorhynchus_anatinus
Mono:SNORD111
Contig48302
SNORD111
1001..1085
1410
TATTTTGCTCATCCACACGTTGCTGCTGCTCCCTCGTAGTAGCTGCCTATGGGCCAGTT
TTGTGTTCACTGGCCAGAGGGCAGTAGTGAAGCTGAAAATAATATGCAGTGGCCGGGAAC
AATTCGGTAGTGTTCATCCAAGGGCTTGGGCCTTAAGAATCTCCTCCCAGCTTCCAAACC
GGGTTGCTTTAACTTTGACTAGTAGAAGACTATGCCGAACCTCAGGGACTTGGAATGAGC
TACTGGCCCAATACACAACCAGCTATTAAGATTGGGTCAGTAGAAGGTGAAACCAGTGAG
TTAGAATGAGCTCTTTGGATCGCCTGTGACCTTGCTTTTTACACACCCCTCCATTTAAAT
GAATGACTGAGAAATATTGTTACCGTCAGTTGTATCAGGTTCAGTCTTGCCTGCAGTACA
GACCAGAAACAGTTTGGAAATAACCATTGTTTCTTTAAAGGGAGGAGTCATTTTTCTTGC
TGAAGTTCTGAAGGAGAATTATAGGTCGGCTCATTGGCCCTAGGATCCTCTTCTTTCCGA
GCCTCACACCCTGATCCTTTCTCCCACTGGGGGTTGTGCTGACCGAAAGCATGTGGCCCT
TCTGTTCTCCCCTCCAGTTACCTGTATCAGATCGCCCACCTGGGAGATGATGACGAGGAG
CCAGAGTTCTCTTCTGCCATGCCTTTGGAAGAGGGAGACACATTCTTCTTCCAGCCTCGA
CCTCTGAAGAACCTGGTGTTGGTGGATGAGCTGGACAGCCTCTCCCCCATCTTGTTCTGC
CAGGTATGGCTTGTCCTTTAATAATAATAATTGTGCTACTTGTTAAGCGCTTAGTATGTG
CTGGGCACTGTACTAAATCCTGAGATAGATCCTTTCTCTTTACTAGTAGGAGCTGCTACC
AGCTCCTGGTGGGGGGATTATTTAGTATCAGGTCATCAGGCTTTGCATGTGTTGCCTTTA
GGGGAGGAGACCACCTGTGGTTAATTCAGAGGGTTTATGACCAGCCTAAGAGATAATGAT
TCTTCCTGTCTCTTCTCTGAGATTTGCTATGAAGAGGCTTGTATTTTTATTCCTCTGATC
AGACTGGTGAAGGAACTTCCTAGCTCTCCTCATTTGCAGAGTTGGTCTGAGTGCTTGCCA
GACGTGACCTGGGCCATGCCATAGTGGGTCAAGCTAAAGATCCATGGGTCTGACAGGGTC
ATCTATTGGGTCTTGGAGGAACAGACGATGCTTGCCCTTCTCGATGTCGGGCACCAATGC
ACATATATGCACACTTCGTGGGGCCTGGCTTTCAATGAAATGGAAGGAAAACTGGTGCTG
GCCAAAGGAGTTTATGGCCTTCCTGTTTTGTCTTAGAAAATGAAAGGTCGTGGGAAGGGA
ACCTATCTGCTACCTCTGTTTTGTTGTACTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved