Ornithorhynchus_anatinus Locus ENSOANG00000030749
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus ENSOANG00000030749
Ornithorhynchus_anatinus
ENSOANG00000030749
Contig48111
SNORA7
1543..1689
6994
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNAGTCAAAGGGCCTGGATTCTAATCCTGGCTCCGCCACT
TGTCTGCTGTGGGACCTTGGGCAAGTCATTTAACCTCTCTGCACCTCAGTTACCTTATCT
GGAAAATGGGAATTAAGACTGTGAGCTCAGGAGGGACATGGACTGTCCAACCTGATTATC
GGGTATCTATCCCAGGGCTTAGAACAGTGCCTGGGACATAGTAAGCACTTCACAAATACT
GTAAAACAAAAGAAAAAGCTAAGGGATGGATCTGCCAGGGGTAGAGGTCTCTAAGCAAGT
TGGGAGATATTTCAGGTGACCTCCTGAGACTGTTGGGATACAATTTATATAAACAATTGA
AAATATCTATCTTAAATGTGTGGTGAAGCACCTTCATTAAAGATGGCAAATCACTTTAAT
TTTGGAATTTTTTCCACTTTCGCAGGAACTAGTGGTGCTTTGCCACCTTCATCACCCCAG
TTTAATATCTCTGCTGGCTGCTGGGATTCGTCCTCGAATGTTGGTAATGGAATTAGCCTC
CAAAGGGTCACTGGATCGATTGCTTCAACAAGACAAATCTAGCTTAACCAGAACACTCCA
GCACAGGATAGCATTACATGTAGCTGATGGCTTAAGGTAACACTGTTAAGCAGTTTTTAT
TGTCTCTGTGAGGAGGTGATCTGTTACCATGGAGGAAGTGTTTGTTCTAAGTCCAATTAT
GGAGTTCAAAACTCACCTATATACCCCAAATACGACATTTCAGTTCACTTGAAGCACTAA
TGTATTCACAGCTGTGACACTGTTAAAAGGTGAACATTTGGCCACAGTAGCGAGGAGGAA
TTTGCTGTGATAATGATAAGCCACTTATTGTGCTTCTCCCCAACCTATGTTAAACTTCTA
CAACTTCCCTCGTAGATGGTTTTTATGAGCCCCTTTAATGCTCCTTCTGTCAGGGTTGCA
CCTGGAGAGTTCCAGTAGTCTACCAGTTCATGACTAGAGGAGTGGAGAGTCAAGCAGAGG
GCCTGTTCCATTCCTTTCCCTCGGCTTGGCCTAATTGGATAGCGAGTTGGAAAGTCAATC
TGCTGGCAAGGTCCAACCCTTCCCCCTGGTGCTGGGNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNGATCATAGGCTACAGCATTAAATATACTTATCTGATGCTCA
AAATTAGCTCCACTGGTAATAATTTTTTAGTAGCTTGCCTCTGTGGAGAACAGCGGGTGC
TGCAGGCCAAGTGGTATGAAAGGAGAATGTATGTGAGAAGGCTGAGAAGAAATGTGGCCT
GATAGATCTCTATCCATGGGTTTGGGAGTCCGAAGGAGCTGGGTTCTAATCTACTTGTCA
GCTGTGTGACCTGGGCAAGTCACTTCTCTGGGCCTCAGTGACCTCATCTGTAAAATGGGA
ATGAAAACCATGAGCCCCATATGGGACATGGACTTTGTTGAACCTGATTAGTTTGTATAT
CCCTCGGAACTTAGAACTGTACTTGACGCATAGTAAAGCACTTAACAAATACCATCATTG
TTATTATTACTTATTGTTATGACTGCGGCAACAATAGATGTGAGGGGAAAGATCTGAAAA
ATCCAAACTGCAGTAAGCACATCTTGACTTCCTCGCAGCTCTTAGGATCTGCCATTTTTC
CTACGTTGGGTTCGATGGGGGCACGGTTACGGGGAAAATGTAGTTCATCTGTTTCTGGGG
ATTTTTTGGTTTCACATTTCTGGGTCCCATTATCCTGCGAGCATTCCTGCTCGCTACAGA
ATTCACCCCAGTGTGAAATTCCTTCCAAAAGTATGTAGGGAGCCAAGTTTTTATTTTTTT
TTAAATGGTATTTGTTAAGTACTTACTAGATGCTAGGTACTTTATTAAACTTATCAGGTT
GGACACAGTCCCTGTCCTACGTGGGGCTCATAATCTCATCCCCATTTTCCAGATGAGGAA
ACGGAGGTACAGAGAAGCGGCTTGCCCAAGGCCACCCAGCAGACAGGTGGCGGAGCCTGG
ATTAGAATCCATGACTTTCTGACTCCCAGTTCCGTGCTCTATCCACTACGCCATGCTGCT
TCTCTGTAACTGTAGTAATAGTATTTATGAAACATTGTATGCAGAGCACTGTCCTAAACA
CTGGGAGAGAACACACAGGTGGGAGTTAGACCCAGGCCTTTTCCCTTGACTAGGAGATTG
ATTCCTTCTCACAGTTAGACTGCTTGTTCATCATTATTAATGCAATCGATATTGATATGC
TTAGCATTCAAAAGTATTTGAGCAGTAATTGTTACAGTTTGAAGAGCTGTTTAAGTCATT
GGTTTAAAGATGAAAATCAATTTGTCTTTTTGAAGTAGATGGTTGTGATTAAAATCACTG
AGCCTTAAAAGTCAAGTTCCTCATATAGGTGGCATGTAAGAGAAACAGCTTGGCCTAGCA
AATAGAGCACAGGCCTGGGAGTTGGAAGGACCTGGGTTCCAATTCCAACTCTATTTGTCT
GCTTTGTGACTTAGGGCAAGTCACTTCATTCCTCTGTGCCTCAGTTACCTCATCTGTAAA
ATGGGAGTTGAGACTGAGCCCTGTGTGGGACTGGAACTGTGTCTGACCTAATTAGCTTGT
ATCTACCCCTGAGCTTAGTATAGTACTTAGCACATAGTAATGCTTAACAAATTCTATTAT
TTTTATTACTATTATTAATAAACCCTTCACAAATACCATAAAAAAGCTCCTTGTGGGCTG
GGAACAGGTGTATCAACTCTGTTGTACTCTTCCAAGCCCTTAGTACGGTGCTCCATACCC
AATAAACATTCAATAAATACCACTGATTGATCAATTGCTCTGATGTTGGATTGGCATGTT
TTGATTTATTCTGTTCAAAAATCTTATAATTAATTTTGAAAAATTAGATTGGTATAGATA
TATCGGTGCTTAGCGTGTTTTGCAATCCAAGGATATTTCCTCTTTTAATTCTTTAAAGAA
TTCATCACATATGCTTTCTGTGACAGATATCTCCACTCTGCAATGATTATATACCGTGAC
CTGAAGCCTCACAATGTCCTACTCTTTACCCTTTACCCAAATGCTGCAGTCATTGCCAAG
ATTGCCGATTATGGCATTGCTCAGTACTGCTGTAGAATGGGGATAAAAACATCGGAAGGA
ACACCAGGTAAGAGATAAAAATGAGTGTTGGTGAATTGTTCAGTTCTTAAAAGAATGTAC
TTTGTCGCTGTTGATTTTGTCTCTTGGAATAATAAAACAAGGCTTTAGCCTGTATCTCAG
AGCTTCATTACATTCCCCCAAGTGCTTGGTGCAGTGTTCTGCACAAACTAAGCACTCAGT
AAATGCAACTGAATGATTAACTGATTAATATTTTTAAGCCTCAGAATTCCCCCTCAAAAT
GTGTCCTCGTCAAAGCAATGCAAACCTGAACTCCAAGTAAAACAAGAAATAGTTGATTTG
AAATGATTTTTCTATTAAGATATGATCAATTAAGTCCTTTTNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1235, 5786..5994
1117..1235, 5786..5957
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved