Ornithorhynchus_anatinus Locus Mono:SNORA63
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SNORA63
Ornithorhynchus_anatinus
Mono:SNORA63
Contig46167
SNORA63
1001..1137
1336
GTTGGCTTCCCCTCGACCCCGAGGTCAACCCCACAGTAGCGCCTAGATAACCTCGCCAT
CATTGACGGTCTCGGGATCGACGTCGGGGCCGACCCGAGGGCCCGCGGTATTTTTTTTCC
GGCCAGTTTAGGCCGACTGACCCGATTTAGAATTCCTTCCGGGGACGCCGCAGAGCGATC
TTGATGTCTCTGGGCATCACAGATCGGTCACCTAGGTAGAATCGTCTTCGGTGGATCTGG
CGTTTTCGGGAACAAGGAAGCTAGGGGGCCGTGAAACAGCTAAATTGCATGATGTGCATT
CATGAGCTGCTTTGCCAGGCTGAGTCGTTCTGTGTCTCCCATTGGGCGCCGAACCAAAAA
TGAAAAGTGTCAGGTGGCCGACGGTAAAGTGAGCTGGGTCACGAGGCGGGGGATAGCGGT
CGTCCCTTCCTGGACATTCACCCGAGTCTCGTGTTTAGATCCAAAAGGTCATCCTGGCCC
TTGGAGACTACATGGGAGCGACCTGCCATGCCTGCATCGGGGGGACCAACGTTCGGAACG
AGATGCAGAAGCTCCAGGCCGAGGCGCCGCATATCGTCGTCGGGACGCCGGGGCGGGTGT
TCGACATGCTCAACAGGCGCTATCTCTGTGAGTTGGGTGGCCCGGGGTCCGGGCGGGGGA
TAAACGTGGCGTGGATGCATCTACCTCGTGGAGATAGTGGAAGGGAAATGATGATTTCGT
GTTTTACCATCTTTCGGGACTGATGTGGAAATGATGATAAACATGTTTCTCTGATTGCCC
TCCTCTGAAGAGGGAGGGGTCGGAGGGTGCCGCGGCGAAAGGTTTTCACAAAGGGTTCTC
TTGAACAGCCCCGAAATGGATCAAGATGTTCGTTTTGGATGAAGCGGATGAGATGTTGAG
CCGGGGGTTTAAGGATCAAATCTATGAGATCTTCCAGAAGCTGAGTACAAATATTCAGGT
AACGGACGGCGGAGAGACTGCGGGGCGACGGCAGTTGGACGACGCGGGTTCCGGTTACGG
TGTAGCCGCGGAGCGCCGTGTTGTCGTTCCCCCTGCCCAGAGCAAAAATCGTCTCCTACC
ATCCCCGGCCGTCTACCTTGACGACCGCGGTGAGACGGGGACGCTTGGTTTCAAACACGC
GGTGTTCGCCCGGCTCGCGCTTTTCTTCCCGAGGTCCCGCCGGGGTGACGGGGGTGGTCC
GTGACTTCTGAAATGCATCTGCCCCGCTTTTATTTTTTTGAAGGTCGTGTTACTCTCCGC
TACGATGCCAACGGATGTTTTGGAGGTGACCAAAAAGTTCATGAGGGATCCTATTCGTAT
TTTAGTGAAGAAGGAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved