Ornithorhynchus_anatinus Locus Mono:SNORD12
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SNORD12
Ornithorhynchus_anatinus
Mono:SNORD12
Contig45376
SNORD12
86..181
1181
CAGCAAGTTCTGACTCTTCTTAGAAAACCATTTTGCCAATGCAAGTCTTAAATCTTGGT
TTCAGAAGAGCCCTTTGCCGGTCAGGTCTGTGGAAAATGATGACTTGGAACTTTTTTCCC
CAACAGATCGACAGTGTTGATCCAAGAAGCATTTTAGCCAAAACCTGTCTGATTCCACCA
GATACCTGACTTGGCCTTCCTGTAACCCCCAGATTGTTCCCCGCTGGTAGGGAGATGCCA
GAAGAGCTTGTCTAATCAAGATTATTGACCAGAGTGTGTGGCAGAGCGTGAGCTACTTGG
TAGCTTGGACTAAACCTAGTGCTGGGCTTACACTCCTTAAATCTGAATTTTCAGTGGTGA
ATGGTGGGTGTTTTTCCCCTTCTCATGCTTATGGATTTCCATAAAATCCAGGTCCTTAGT
TGACATTAATGGTGCCTCTGCCATATTTTTGCCTATGGCCAAATACCATTCTTTCCTGTA
CTGCTGCCCAACTGAAATGTCTTTACATAGCTCAGCAGGGAAGGTAAAAAGTGAAGCAAA
ATGCATTGTGAAAAGCTAAAGGCATATGAAACTGAATGCCTGGCCTCTAGGTGTTAAATA
TTTGGCTTTTTCCCCAACAGGTAAAAGCTTGGTTCAGGAGAAAGAAGCAAAAGAAACTAG
GGATTGTCCCAGTTTTCTACTGCCACGAGGACAGTCTCACCTGTTAATGTACTTTCACTG
AAATCTGGGCTGTATTATTTCCCGAAATACACCATTTTTTTCCAAATAAAGTTTTTTTGA
GAACCAACTCTTCAACTCTGCCTTTGTATTTACTGAAATGTGAACACACTTTCTGACTTC
TAAGCATTTGACTTGGGTTTCTGTGGGCAAGTGTTTTGGTATTCAAATAAATCCATTAGG
GATTTATTTTTGGGTGAAGGGAAGGGTATTGAGATGGGACATTCCTGATGGAACGAGTAT
GGCTGTGGCAGTCAGGTCCTTTCACTTGGTTACTCTGGGCAAGTCTCAACTTTGCTCTGT
TTCGGTGTTTTTTTTTTTAAATAGGGATTTGAAACCCATTCTTTCACCTATGGAGGGAAG
GAGACTTGAGTCCAGCTTCCAACCTAATTAGAATTCTATTTAAGTCTTTCACACAAACAT
CCATAAGAAAGAAGCAAGAGCTTGGTTATGAGTTCTAATCCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved