Ornithorhynchus_anatinus Locus RPL3
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus RPL3
Ornithorhynchus_anatinus
RPL3
Contig4527
SNORD43, snoU82P, snoU83B, snoU83B
5224..5303, 5711..5766, 6893..6985, 7596..7688
12560
TATATATAAAAAAGCCGGCGACCCGCTCGCTCTCTCTCGCTTCGTCGACGTGGCGTCGT
CATGGTACGTGCGGCCATGGCGGGCGGCTTGGGCTTGCGGGAGACCAGGGGCTGGGACTA
TCCGTCTCCATCGGCGCCATCGCGACTCCTCCGTGCCTCCCTCTCTTCTCGGCGGGGAGA
GGGAGCCCCGGGGGAGTCGGAGGCGGCCCCATTTTCGGGGTTCGGCGCTGGCGAGGGCGG
CCAGGGTGCTGGATGCGGGCCCGAGGCTGGGCGGCCTAGATGGCATGAAAGGCATGGGGC
ACCACTGGATCCAAATGATATCCTCGATGGGTGGACATAAAAAACCTAATTGCCGAGTTC
TGATTGCTTCCTGAAGCCGGTGGGGAAGCTGGAGCCCCTGGGATGGGACTGCCCTGTCAA
TTCAGGACGACCTGGACGCTTTTTAAGCAGCCCCATGATCAGGTCGAGCGCTTAGTCCAC
TGCTGTGCACATAGCGCTCAATAAGTACTATTAAATGAATCCCTGAAAGGGGTTCCTTGC
AGGCCCCAAGAAGTGCTCCCGAGGAAGGTGGGGCAGGGCTCGTGGGGACGAAAATGCAGC
GTTAACTAAAGATGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCAAGGATGACCCCACCAAGCCCATCCACCT
CACCGCCTTCCTGGGCTACAAGGCGGGCATGACCCACATCGTGCGGGAAGTCGACAGGCC
TGGGTCCAGTGAGTCGTCGCCTCTCTTTCTTGCATTCACTTTAGCTCCCCAAAAAGGGCG
GGGTTTAAGTGCTTGCTCTGTGCAGAGCACTGTTCCAAGCGCTGGGGGAGATACAGGATC
ATCAGGTCGTCCCACGTGAGGCTCACAGTCTTCCCCCATTTTAATAGTATTGTTGGTATT
TGTTAAGCGCTTACTATGTGCAGAGCACTGTTCGAAGCGCTGGGGGAGATGCAGAGTAGT
CAGGTTGTCCCATGTGAGGCTCACCGTCTTCATCCCCATTTTAGTAATAATGGTGGTATT
AAGCGCTTACTATGTGCAGAGCACTGTTCTAAGCGTTGGGGGAGATACGGGGTCATTAGG
TCGTCCCACGTGAGGCTCACAGGCTTCCCCCATTTTAATAGTAATGTTGGTATTTGTTAA
GCGCTTACTATGTGCAGAGCACTGTTCGAAGCGCTGGGGGAGATGCAGGGTAATCAGGTT
GTCCCACGTGAAGCTCACCGTCTTCATCCCCATTTTAGTAATAATAATGTTGGTATTTGT
TAAGCGCTTACGATGTGCAGAGCATTGTTCTAAGCGCTGGGGAAGATACAGGCTAATCAG
GTTGTCTCATGTGAGGCTCACAGTCTTCATCTCCATTTTAATAATGTTGGTATTTGTTAA
GCGCTGACTATGTGCAGAGCACTTGTTTTAAGCGCTGGGGTAGATGCAGAGTCATCAGGT
TGTCCCATGTGAGGCTCAGTGTCTTAATCCTCATTTAACAGATGAGGGAATTGAGGCACA
GAAGTTGAGTGACTTGCCCACAGTCACACAGCTGACAAGTGGCCGAGGCTGGATTCGAAC
CCGTGACCTCTGACTCCCAAGCCCATGCTCGTTCCACTGACCAACACTGCTTTCTACCCC
CAGCGCCTTGAACAGTGCTTGACACATGATAAGCGCTTAAACACCATAATTATTAAAATG
TCTTATATCTACCCACAGCGTTTAGATCAGTGCTTGGCCCGTAGTGAGTACTTATTGTAG
AATATTATAGAATTATTATTTTGAAGCAGCAGTGTGCTTTAGTGAAAAGAGCATGGGCTT
GGGAGTCAGGTCGTGGGTTCTAATCCTGCCTCTGCCACGTGGCTGCTTGGCGACCTAGGG
CAAGCCAGTTAACTTCTGAGCTTCAGTTACCTTATCTGTAAAATGGGGATTAAGACTATG
AGCCCCATGTGGGACAACTTGATTACCTTGTATTTACCCCAGTGCTTAGAGCGCTTGACA
CATAGTAAGTGCATAACAAATACCGTCATTATTAATCCTGCGTTCTTCTGTTCTGTGACC
TTGGGCAACTCACTTCACTTCTCTGCCTCAGTTACCTTGTCTAAAATGTGACTGAGCCTT
AGGTGGGATAGACCGTCCAACACGATGTGCATGGATCCACCCCAGCCCTTAGTTACGGTT
CTGGGCACGCAGTAAGCATTTCAACGAATACTGTTATTATTAAGCTAAATAAGGTTGGAC
ACAGTTCCAGTCCCACATGGCTCACAATAAGGAGGGAGTATTGAACCCTCATTTTAGGGC
TGAGAAAAGAGAGAACTTTTGGTAAGATGACTTACCCAAGGTCAAACGAGACACGTGGCA
GGACCGGCATGAGAGCCCAGATCCTCCCAGGCCCGGGCTCCGTCCACTGTCCTAGGCCAC
GCTGCTTTCTCCTGTAAGGAAAAGGTTTTTCTATTCACCAGTAGAAGGGAGCCGCGTTCT
GGGTTACACTGTGCATGTCATTGTCTGGCACAAGGTGACAGCGTGTGCTGGGGCCTACCT
TAGTCTCCAGTGGGAAGAACGAGGACTTGGGTTCTAGTCCTGGCTCTGTCATTCAAATTC
CGTGACCTTGGACAAGTCACAGTACCTCAGTTCCCTCATCTGCAAAACGAATAGAGCACC
TTTGCCCCTTGTGACCGAGCCTCATGTAGAACCTGATTACTTTGTATCTGCCCCAGCACT
TGGGAAGTGTTTTGACCTAGCAATTGCCCTGATTAGTGGTGGTGGATGGGAGTATCCCTG
GGAAACCATGGAGGCAGAGACTCTTCCAATCCGCCAGGGTAGTGACATGCAGAAAGAGAT
GTGGTCTGGGCAGGAACACGGCAGTGTTGTTGCAGTACCTTGCTACAGGACCAAGCTACT
TATCCACCATCTCTGAGAGGCAGTGTGACCTAGTAGATGAGAGTACGGGCTCTGGAGTCA
GAGGGACTCAAGCAAAAACTCCTATCGACTTCATTGCAGTCTATCACCTTGCTCCCTTCT
TACCTCACCTTCTACACTCCTAGTGCCTCATCTGTCCCCTGGCCCATGTCATACCTCTGG
CCTGGAATGCCCTCCCTCCCCAAATCTGCCAGTTACCAATCTGCCCCCCTTCAAAGCCCT
GCTGAAGGCTCACCTCCAGGAGGCCATCCCACAATAAGCACCCTTTTTTCCTCTCCTCCC
CATCGCCCCTACTCCCTTAACTCTGCCCCCCGTCCCCACAGCACTTGTGTATATATTTAT
AATTCTATTTATATTACATGTATTATGTAATTTTATTATTGATGAGACTGATGCTTGCTT
ACTTGCTTTGATTCCTTTCTCTGCCCTCGACCGAGCCCATTGTGGGCTGGGATTGTCTAT
TGGTTGCTGAATTGTGCTTTCCAAGTGTTTAAGGGCAGAGCTCTGCATAGTAAGCGCTCG
ATGAATACAATTGAATGAATAAAGGCCTTGAGTTCTAATTCTGGCCCTGCCATTTGTCTG
CTCTATGATCTCATCTGTAAAATGGGAGTAATCCTGTGAGCCCCATGTGGGACATGGTCT
GTCCAACCTGATTAGCGTGTACTTTTCCAGTGCTTAGTACGGTGACTGGCATAGAGTATC
AGTAAAAAAATGTTCAATTTTGTGTGTAATGTGTTCTACACATTCATAAACTCAATACAT
AGTTGCAACCGCATTCCAGACTTTTCACACCAAGAAAAGATTCCAGAAATTCTAGTTATT
ATACTGTGTTGACCAACTAAGGGAGAACAGCAGTCACTTGAACCCAATGAGAGGTGGGGG
TAAGGCTCCCTAATTCTAAGTCTGTAGACCATTTTGTAGCAGGAGATGTGTCCCATTAGG
CCTATCACCACAGTCTGCTGCCTACTTATTCCCTCCCTCTTTGTAGAAGAATAATATTGG
TATTTAAGTGCTTATTGTGTGCTGAGCACTGTTCTAGGCACCGGAGTAGATACAGGTTAA
TCAGGTTGTCCCACATGGGGTTTAGTCTTAATCCCCATTTTACAGATGAGGTAACTGAGG
CACTGAAGTGAAGTGACTTGCCCAAAGTCACACAGCTGATAGGAGGCAGAGCTGGGATTA
GAACCCATGACCTCTGACTCCTAAACCCAGGCTCCTACTGAGCAACAGCCCTGCTCCTCA
ACTTTGAAGCCCTACTAGAGGCCTTCCCCGATCAACCCCCAACCAACTCCCTTTCGGTCT
GTATCTTTCAAGCATTTGATATCCACCTCACTCTTAGCCTCAGTATGCATTTGTATGTGT
TGAGCCCCTCTGAACTAGTTCCTTGTCGGCAAGGAACATGCGGTATATTGAGCGGTGCTC
TGCACAGAGCAAACCGCCAATAAATAGCTTGGATTTGGTTGTATCCTAACTGAGGTTTGT
GCCTCTCTTCCCCTCAGAGGTGAACAAGAAGGAAGTGGTAGAGGCCGTGACCATCGTGGA
GACCCCACCCATGGTCATCGTGGGTATCGTCGGCTACGTGCAGACCCCCCGCGGCCTCCG
CACCTTCAAGACCATCTTCGCCGAACACATCAGCGATGAGTGCAAGAGGCGTTTCTACAA
GAACTGGTAAGGACGCCGGGAAGACCAGAGCTCCACCTGACTCGTGAAGTCTGACACGTT
TCAGAGTTGAGTTGATGAGATGGGGCGGGCCTCACTTCCCAGGGGGTGTCATATGCCCAG
ATGGGTAGGGGATGTGCCTTCAATTACAGGATAACCAGCACCCAAATGTAGATCAGATAG
GCCCGAAGGAGGACGATGGTGGGATTTTCCTTGGGGTGTGTCGAGGGAGGTTTGGGAAAT
GGACTACAAGTGATGAGACCCTTGACGGGCGGACATAGGAAACCGCCTCTGGCGCTTGAT
GCTGATTGTCAAGTTCTGAATGTAGTTCTGTGTCCTCTGGGCGAGTTGTGATCTGAACCA
GAAAGGATGATGGGCCTGGGATTTTATTTACTATTTTTGCCCCCAGAAAAGCCCAGCCGT
AGTGTTAATTGCAGTCAGTCGATCCACTTTATTGAGCACTTCGTAGGTGCAGAGTGCACA
ATTTTTCTGTGGAGCCCAGGGAGGTTTCCTGCCCAGTTAATGGCTGAGGGGAACAGGAAT
TGCAGTGTCTGTTCCGGATGCCTTTGACATCTATTAACACGCTCCGACCATCCCGCGGCA
GCTCCGCTCGGCTCTGGCGACCCCGCCTCTGCCCGATGAGCTCGGCTCCGCTTGCCGGTG
GAGAGGACTCCTCGGAAGCCGGCAATGAGCCAGGACTCCTTGGCCCCGGCGCCTTCCGCT
CGACCCCGAGGGGGCCGATGAAGGGCTGAGCCGAGACCCCCTCCCCAACTGTGCTCTGCT
CCTGAAGGCACAAATCCAAGAAGAAGGCCTTCACCAAGTACTGCAAGAAATGGCAGGATG
AGGAGGGCAAGAAGCAGCTGGAGAAGGACTTCAACAGTATGAAGAAATACTGCCAGGTTA
TCCGTGTGATCGCTCACACCCAGGTGAGTGGCCCGGGACCCGAGGGGGGGAATTGAGGCT
CGGGAACCGGGGTCAGGATCCATCTGACTCCCGGCCCGAGGGGAAGACCTGGGGATATCG
ATGATTGGGGGCCCCAGATTGGCCCCGGGGTCAGGATCCATCGGAGTCCTGGCCGCCCTG
GTCTGTGCTCTACTAGCCCAGAGGTGCTTGTTCTCTAGGAACTGCCAGAAGCCTGGGTTT
AAAGCAGACTGGACTAGCCATATGGTTGGTAGCGAGCCCTTGGGGCTGCTAATGTTCAAC
CTTCAGCTCAGCATGGGCTCGGGGGCAAATTCCAATGTTGCCAGCAGGGGGCACTGCATC
CCGCGTTCTCCACTTGCCCTAAAGGAGAAGCTTGCCCAGCTGGTGTCCCGCACCACTTTT
ATGATATTTTAAGTGCTTATTATGCCAAGCACGGGGCTAGATTCAAGCTAATCAGCCTGG
ACACAGCCCCTGCCTCACCCGGGGCTCAGACTTTATCCCCCTTCTACGGAGGCGGTAACT
GAGACACAGAGCAGTGAAGTGTGACCTGCTCCAGAGCCAGGATTAGAACCCAGCTCCACC
TGGATCCCAGGCTCGTGCTCTCCACTAGGCTGTGCTGCTTCTCCACCCACCATCTCTGGA
GTTCAGATCACAGTTCAGTTTTTTTAATACAGCAACAGGACAGGGCCTGTTCTCCAAAGG
GTCTGGCAGAGCTCCGGGTACTATTTAACCAGTGGACACCAGGGCATGAAAGCCTTGCTC
AAGGCTGGCTGTAGGCATTCATTCAGTTGTATCTATTGAGTGCCTACTATGTGCAGAGCA
CAGTACCAAGTGCTTGGAATGTGCAACTCGGCGACAGGTAGAGACAATCCCTGCCCAACG
GGCTCCCAGTCTGCAAGGGGGAGAAAGACAAAAATAGACCGGCAGCGTGGCCCAAGGCAA
AATGGCCCAGGCCAAAGCCCTGGTGCACCACAGTGGTCCCTCAGGCAGACCAGACCGTTC
AGTGATGAGTCGCTGGAAGAAGCGCCGGGCACGGCGCCCGAAACGAATGAGGATACTCTC
CTTGCTGCCTTCCTTCTGAGAACGGTCACCTCTCCCGGTCCTGACCCGGTGATCGGCAGG
CTGGGCCAGAGCTGGGACCGGTACGGTCGGCCCCTTTCCCTCAAATGGGTGTCTTCTGCC
GGCTGAGCGTTTGACTGTACCCGGCCTGTTCGGCGCTCTTGGTATGCAGAGCACTGGGCT
AAGCATTTGGGAGAGCCTGCTCACGAGCCTAGGGGAGCCAGACGGACAGTGTAAATTACG
GAAAATAACTCACGGCTGAGGGAGCATTAGAAAAGGAGCGAGTCCCAGGCACCGAAACGA
TAAGCCACCGCCCCCCCCCCCCCCCATCGCTCCCGCTAGTCTGACAAGTCCTCCGCCTCT
TGTGCAGATGCGCGTCCTCCCCCTGAGGCAGAAGAAGTCTCACCTGATGGAGATCCAGGT
GAATGGCGGCAGCATCGCCGAGAAGGTGGACTGGGCCCGGGAGAAGTTGGAGCAGCAGGT
GCCCGTGGCCACGGTCTTTGGCCAGGACGAGATGATCGACGTCATCGGTGTCACCAAGGG
CAAGGGTTACAAAGGTAGGTGCTCCTTTCCAGAAAATCCATACCTGACCCGCTGGGGATG
GGGGAAGGGGCTCGATGCCCTCATCCCCGGGGCCGGGCTGTTCAGTGATGAGGCACTGGA
AAAAGCGCCGGGCACGGCGCCCGACCCCGATGAGGAATCCTTCCTTGCTGCCTTCCTTCT
GAGAACAGCGCTGAGGTTGGGATGCTGGGGGCCGGCCGTACCGGGAACCCCACCCCGTGG
GCTCGACTCGAGGGTAATGATGGCATTAAGGGCTCTGTGTGTGCCACGTTCTGGGGTCGG
AGCATGTTAGACCCTGTCCTGCCTTATTTTGAGGGAGGAGAGCAATCAGTGGTATTTACT
GACCGATTAAGGTGTGCACAGCTCTCTACTAAACACTTAAGAAGAGTAAGGTCTAGTGGA
ACGGTCACACGCCTGGGAGTCGGGAGGACCCAAGTTTTAATCCCCATTCTGCCACTTATC
TGCTGTATGACCTCGCGCAAGTCACTTAATCTCTCCCTTGAAATTAGCTCACCTGTGAAT
GGGGATTAAGATGGGGAGTCCCATGCGTAACATGGACTATTTCCAATCCGATTAGCACGT
ATCTGCCCAGCACAGTGCCTGACAACACAGTAAACACTTAATAGATGTCATTAAAAAAAA
ACAGCACTAGGGGACACGTTCCCTGTTAGAGGCTTTGCAGAAGAGGAAACTGAGGCATAG
GAGATAGTTGCCCAAGGTTAAACGGGACACCTTATAGTCACCTGCTTTTCAAGTTCCGCT
CTCTTTCCACCGGCCCCCCTCCGCTTCATCAATTTCCCCCTCCGGAACTCACGTGACCCT
CTCTTTCAGGGGTGACCAGCCGCTGGCACACAAAGAAACTCCCTCGCAAGACCCACAGAG
GTCTCCGCAAAGTAGCCTGTATCGGGGCCTGGCATCCTGCCCGCGTGGCCTTCTCTGTGG
CCCGCGCCGGTCAGAAGGGCTACCACCACCGCACCGAGATCAACAAGAAGGTGAGGTGTG
AAGGGAGCCGGCTGGGTAGGACTGGGTGACAGTGAGCCGGCCGGCTCCGGGAACTGCTGA
ACTTTTCTGAGTCTTTCCCTCGCATCCACCCTCCCTCTCTGTTCCCAGTGAGCTGCGGGT
CGGCTCCAGACGCCGGAAAGTCCAGGCTCTGGCTGTAGGTCCCCAGGGATCCATCCCAAC
TCTGGACGCGGGACGACTGGGCTCTGATCTCTTCCCCTGTCAGCATCTTCTATCGCTTGT
TTGTTCCCTGAACAATACGGGACATGTGGAGATCGCATTCTCTACCATGTCCCGCCGCAC
TGCTCTGAGGGGCTTGGCTTCCTGCGAGCACCTCGGTGGTTCCCCTGTGGCCGGGGAAAC
TGCCTCGCGGCCCTCCGGTGACACGCGCCCATTGTTCGAGAAGGGCGAGGCCGTCTGCCC
TTTAACATGAGGCACAAGTGCCCCGGAGGAGGTGGCCCGTGGCTCCCTGGGTGGCTGCGG
CTCCTGCTGGCCTTGGGCTTTCCCCTCTCGCCTCTCTACGTGGCCTTACTGAAGTGCTGC
TATCCTTCCCTGGGGAAGCAGCGTGGCTCAGTGGAAAGAGCCTGGCCTTCGGAGTCAGGT
CATGAGTTCGACTCCCGGCTCTGCCACTTATCAGCTGTGTGACTGGGCAAGTCACTTAAC
TTCTCTGGGCCTCAGTTACCTCATCTGTAAAATGGGGATTAACCGTGAGCCTCACGTGGG
ATGACCTGATGACCCTGTATCTCCCCCAGCCCTTAGAACAGTGCTCTGCACATAGTAAGC
GCTTAACAAATACCAACATTATTATTATTCTATTCAGATCTACAAGATTGGCCAAGGCTA
CCAAATCAAGGACGGCAAACTCATCAAGAACAACGCCTCCACCGACTACGATCTGTCGGA
CAAGAGCATCAATCCGCTGGTGGGTGTCCCTCTTGGGTTGGAGGCCCCGCCCGACTCCCC
TCCCCCGGCCTCCGCCAGATATGCTGCGCTCAGCAGCAGCGGCCCCCCAGCTGGCGGGGT
TGGACGCGGCTCAGGGAAAGTCCAGGTGGTGCAGGGACGGGCTGAATCATAGGGTGCACT
GTTTACCAAGTTATTAACTGATCCCGAAGCCCGAAACTCCCTTGGCAGCTCCTTGCAGAA
GGCAAACCTCCATCTATTGTAGCTGGCTCCAAGCTGAGGGATTTGCATCCTGCTGACTCC
GATCTTCTCCAGAAGATCGCAATCTTCCTTTCCCTCACAGCTGGCCCCCCGGAGAGCACG
GTGTCTGCATTTCGGCCTTAGCCATCTCCCTGCCCACCTCAACCCCGTGTGGATTGCTCG
GGGTTCCCGGCGTGCGGGGAGGATGGCGGCGAGGCTGGGGAAAGGGTTAGCGATGTTTTC
TTTTTGCACTTGGGGGCCAGCCTCTTGGGCTCCTGTGTCCACGTCAGCAAATGGTATTTG
AGGAATTACTGTAGGCAGAACACTGTACTGAACGCTTGGGAGAGTACAGAGTCTTAAGTG
AGTCTGTAGACCCGATCTCCGCCCGCAAGGAGGTTAGTCTTGAGGGAGACCGACATTAAA
ATGAACGATAAGGGAAAGAGGATAAGGGTTATATTCCAGTGTCCTGGGGGTGGTCTGAGG
GCCGAAGGGCTGCCATCCTTCCCCGGGGAAGCAGCGTGGCTTCCCAAGTGGCACCCAAGT
GCGTAATCGACACCGAAGGCAAGGTGGATAGGATTGGGAAATAGCGGTGATGTTTCACCC
GCCGTTTCTTCCGCAGGGAGGCTTCGTCCACTATGGTGAAGTGACCAATGACTTTGTCAT
GCTGAAGGGTTGCGTTGTGGGAACCAAGAAACGTGTCCTCACCCTCCGCAAGGTGAGCAG
GGCTTCGGGGTGCCGGCCATCGGGGCCGCGCAGGGCATTTGAGAGGTGGAGTGGAACACC
CGGCCTTCTGTTGTAGCCAGGGACTGGCTGCGGGGAGGAAGGGGGTTATTGGTGTCGTGC
GAGGAGGGTGGTGAGGAGCCGTGAAGGACCGGCCCCTGACCGGGCTGCCCTCTGTGCCCG
TAGTCTCTTCTGGTGCAGACCAAGCGCCGCGCCCTGGAGAAGATCGACCTGAAGTTCATA
GACACCACCTCCAAGTTTGGCCACGGCCGCTTCCAGACAGTGGAGGAGAAGAAGGCTTTC
ATGGTGAGGACCTCCTTTTCTCCTTCCCCATCCCCCTCCTTGCTCTCAAGACAGCAGATG
CCATGACCTAAACTGTTTGTTGTCTACAGATAAGTCTAGAGATTGCACGCAGGAAACCTG
CCGGACTAGCTCTTGTGCAACCTCGCACAGGGCTGCTGCTATTTGCTCAGGATGAGGCTG
AGCTGGAAAGCATTAGAGGAGTGAATTCAGGGCGGGGGGAGGCGGGAAGAGGGGGACAGA
CAGCCCTCGAAGCCTGAGACTTCCCCAACTCGTGTCTGGCCCGTGCCGGGAGTCACCGCA
GAAATCTAACAGGGTGGCACTCCGTGTTGGCACTTTCCTGCTGCTGCCGCTTCCCAGCTC
AGATCTCCATGTGGAGAGGCGGCATGGATGCGAAGGAAAAGCAAGGACCTGAGTTTCCAA
TCTCAGCTCTACCACTTTGCTGCTGTGTGACTCTGGGCACTTTACTTCCATGCTCTGCAC
CTCAGCTTCCTCATCTGCCAAATGATTCACTGAGCCCCTTGTGGGACCTGATTGTCTTGT
GTCTAGCTCAGTGCTAGTAAGGGCTTAACAATTGCCTCAATTACTGGGTTTCCCTGGTTG
GGTGTCTCAGCTGGGGTCAAGAGGGTGGTGACAGGACTGCTGGGTGGGGACCAGGTAGAG
AAAGCTAGAGGCCGAATCCCCCTGCCTAAACCGTGATGGTCTGCCTTCCTCTCCCACTAA
CATAGTCATGACTTCTTTCCAGGGACCACTCAAGAAGGACCGGATTGCTAAAGAGGAAGC
TGCTTAATGCCAGGGACCGATTGGGAGCAAGCTGGTGGTCTATGAATAAAACAATTGTAT
AAAAACTTGGTTTGGGTGAATCTTCTGACCAGGAGCCAGGGAAGGATAAGTAGGATCCAA
GTCGCCCTTCCCATCCCACCCCCCCCCCCCCCACACAGTCCACTCCAACCCTCACATGCN
NNNNNNNNNACCAGGGGGGTGTCACCCCTAAAAGCTCTCATTCACCTCAGTTCCGGAGAG
GGACGGGACTGAAGCGGAGGGGGGCCGAAGGAAAGGGAGCGGGACGAGTAAACCTGGTGA
AAACGAGGTGTTCCGCTTAACTTTCGGTAACTTTCTCATATGCTTCTGTTTCCAGGGACC
AAAAGCCTCTAACAGGGAACGTGTCCAGGAGGGTGCTTAATGCCTAAGGACATTTAATAG
CAGTTTACTGGTCCAAGAATCAACCATCTGGGCAGAAACTTGCTCCTGGGATGGGAAATA
GTCCGTGCCCGCAAAAGGACTCCCGGATTCAAGTCGCCCTTCCCATCCCACCCCCCCCCC
CCCCACACACACAGCCACTCCATCCTCACCTGCTCATGTGCATCAGGGTGTTCTGTTCCT
GGACTAAGGATGGGGAGATGTTGTGCCACATTGTCACAGGGCAGCAGGAGATCTTCCACC
GTGCCCCCCGGAGTCAGGACGTCACCCTAAAGCATCCCACCTAAACAGGCCAATGTCACC
CGTGCTGGCTGTAGCTCTCCCCGTCCGACCACCACAGGACGTCTCCGCCATGGCCACTTG
TCATGACTAATTGTTGGATGTTTGCCCAGCCTGGCTGGCTGTTTGCTCACCTGCCTTCTC
CCCTCCCTATCCCTGCCCCCTTCCTGATTCAAGAGCAAGTAATAGGCAGGTGCCACATGT
TTCAGAACTCTTTGGGCCTGGTAAGTTGCTCCCCGGGGGGAGGATGGGCAGATCTCAGTA
GGGGTAGAGGGACAGTAGCCTGGATGTGCCAGACCTTGGCTGCTGGGGTTTTCAAGGGAT
TTGGAACAGAGGTTGACTTGCTTGCATTTCTGCTCTGGGACCTCAGGTGCAATATAAGCT
TCAGTGGTCATCAAGCGGGAC
  Untranslated Region
  Coding Sequence
  snoRNA
1048..1147, 4817..4985, 5767..5902, 7327..7513, 8349..8509, 9337..9438, 10276..10371, 10563..10682, 11422..11560
1108..1147, 4817..4985, 5767..5902, 7327..7513, 8349..8509, 9337..9438, 10276..10371, 10563..10682, 11422..11466
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved