Ornithorhynchus_anatinus Locus Mono:SNORA50
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SNORA50
Ornithorhynchus_anatinus
Mono:SNORA50
Contig4325
SNORA50
1001..1117
1822
AAGGCCAATAATATATGAAGCTTCATATTCATAACCAACCAGAAGCATTCAGAACCATT
TTCATAACCAAACATAACCATCTAATCTGGAAACTTTTGTTTGTCCATACAGAGGGATAA
ATTTGAAATAGACTCTGAGAGCTAAATGCCTCACTTAGCTGGGAATATTCTTGGTTCTAT
CAGAACAAAGAGGAGGATGGCAGTGAAACACGGTCATTGTCTAAGCAGCATATATTCAGT
GGCCGCGGCTACTTAACTTTCAGGCTTCTGTGCCGATGTAGGAGAAGAAATGGTATTTGT
TAAGTGTGCTGGGTGCAGTGCTCTGCGAAACAGAAACATGAGATGAGCTTGCTGCCATCC
AGGAGCTTAGACTCAAACAGGGGAGATGCACACAAATGTTTACGAATAGAGTAATCAGAA
TAAATATTCTATCGTAGAGTTTATTATACATATATACACAAGTGCAAGGGAAGGACAAGA
ATAAATACATATCAGTTAGAGGTGGCTGCTGGGTGTCTTATGACGCTATGCTCATCACAT
CAAACCTCTGCTGGGTGGAACTTATGAGTATTAGCATTCGTATTGGGAAGCGGCATTGCT
TAGTGGAAAGAGCATGGGCCTGGGAGTCACCAAATTTTGTCAGTTCTACCTTCATAACAT
CTCTCAAATCCACCCCTCCATCTCCATCCCAACTGCTATTGATCGATAGTCTCAGAACCT
TGATGAACTCTTCAGGGCAGCCAAATTTCCTGAGCAGTTTCCAGAGGCCTGATCTACCGA
TGCTATCCAATTCTTTGGGTAAGGTCTAAGAAAATGGCGTAGAGGTCTTAGTGCTGTATC
TTGCACTCCTCTTGTATCTGATTCACTGCAAAGATCCTATCTGCTGCACAATGCTGTGAT
CTGAAGTTACACTGTGATTCCAGGAGCATTTGCTTGGCGATATCTTTAAGCATGTGTTGA
AGTACTCTGGCTAAGATCTGGCCAGCAATGGAGAGTAATGTGTGCACTGTCTTTGAACGC
ATGGAATGCCTTGTTCGTGACTCTTTGGGGTTCGCAGCAGTGCAGAACTGTGAGTTTGTT
TATAACTGCCTTATTGAAGCCTTACTGAGAGCACATCTCCTCCGAGAGCCCTGCCCAGCC
TAAGTCCCCCAATTTCCTCTTCCCCCACTCCCTTCTCAGTCGCTGTGACTTTGTTCTTCC
CCCATCCCAGCCCCACAGCACTTATGTACATATCCATAATTTCTTTATATTAATGTCTGT
CTCCCCCGTTCTAGACTGTAAGCTTGTTGTGGGCAGTGAATGTGTCTGTTTATTGTTGTA
CTCTCCCAAGCACTTACTACAGCGTTCAGCCACAGTAAGCTCTCAGTGAAGACGATTGAA
TGAATGAATAATGAGATGCCTCGAAAAGCACTGCAATCTGACCTTTCACCTTTCTTCTTG
AAGATGATGACAGTGGTGGTATTCTTGAGAACCTAGTGGCATTTTCTCAATTCTCTCTAG
ATTGAGGAAGAGCTTGGGCAAGTATTTAAGATATTTAAGCACAGATGCTTTCCCATTTTT
CTTGGTTCTGAGCATTGTGATGAATTCCCTAATTATTGGGACGAGTGCAGTATCAAAGCA
CGTTGAAAGGCTTCAAATGTTTAGAAGGTCCTCATCTTCAACAATGGAAGGCATGTCAAG
GCGGACACTGAAATATTCTTAACACCTCTTCTTGTCTAGGAAGAGCCCGGAGGAGTCTTC
ATTCTTCAGAGGTGCCGTGATAGCATAAACCCAGCCAAATAAGATCTATAGCAAAATATA
CTAGTAGTAATAGTATTTATTAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved