Ornithorhynchus_anatinus Locus Mono:SCARNA8
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SCARNA8
Ornithorhynchus_anatinus
Mono:SCARNA8
Contig42585
SCARNA8
1001..1132
2132
AACTCCTCACTCTAGGCTTCAAGGCTCTACATCACCTTGCCCCTTCCTACCTCTCCTCC
CTTCTCTCTTTCTACCACCCACCCCGCATGCTCCGCTCCTTTGCTGCCCACCTCCTCACC
GTCCCTCGGTCTCGCCTATCCCGCCGTCGACCCCTGGGCCCCGTCCTCCCGCGGTCCTGG
AACGCCCTCCCTCCTCACCTCCGCCAAACTGATTCTCTTCCCCTCTTCAAAACCCTACTT
AAAACTCACCTCCTCCAAGAGGCCTTCCCAGACTGAGCTCCCCTTCTCCCTCTACTCCCT
CTACCACCCCCCCTTCACCTCTCCGCAGCTAAACCCTCTTTTCCCCCTTTCCCTCTGCTC
CTCTCCCTCTCCCTTCCCATCCCCTCAGCACTGTACTCGTCTGCTCAACTGTATATATTT
TCATTACCCAATTTATTTTGTTAATGAAACGTACATCGCCTTGATTCTATTTAGTTGCCA
TTGTTTTTACGAGATGTTCTTCCCCTTGACTCTATTTATTGCCATTGTTCTCGTCTGTCC
ATCTCCCCCGATTAGACTGTAAGCCCGTCAAACGGCAGGGACTGTACCTGCTGCCGACTT
GTTCATTCCAAGTGCTTAGTACAGTGCTCTGCACATAGTAAGCGCTCAATAAATACTATT
GAATGAATGAATGAATGAAAGGGTTAGGAGCGTTCGATGGGGAATTTTTAACCATAAGGA
TGGATGTCAGAGAGGGCATCCTACCTTTTCTCCTACTACTTTTTATTAGTCTTTGTTGGA
AACAGAATCCCAAGATAGACAGTGGTTTTGCCCAGTGTGTCTATATTCTTGTGCTAGATA
ATCCATTTATATGTGGCATAAATTTTACGTAGTCGATTAATTTTTGTCTTAATTTTGCAA
ATAGCCAGCAAGTCACTTAACCTCTCTGTTCGAGACTGGCCATATCAGAATTAAAGATTG
TTAAACAGTGCGATGTGGTTTTTTGCCTTTTTAATTTTTATTGGGAGACTGATACACAGA
TAGGGCTGAAGTACTGCTCTAAATGTCACAATGCCTCCCTAGAATAAAACTGCCTTTTGA
TGACCGGAACGAATTGAGTGAAATCGTAACGGACAGATACGGGGCAGATAACTTTTGGGA
ATGCACTTTTATTATGTGAATTGAAAGTAGTATTTTTCTATCAGTAATCGACATGTGGCT
CTTTTTAGGATTCCTCCATTTCCGACACAGTCCACTCCACCATCCAGTAGCAACAGTGAG
ATTCTTCTTGAGAAGGTAAAGTTTTTTGGTAATTATCCATTGTTTTAAAATTGTATTCCC
TTTAAAAACTGTACTTTGTAGACTTCCATAATTCAATTAATAGCCCACAATTGCTTAATG
AAGTTTACATACACTCCCCTTACTCCTTTTATTCTATTCCCCCCCTCAACTTTAGGAACA
ATTAACTGTAATATTATAAACATATTATGCAGGAAGTCTTTGGACTTAGGACAGAAGTCT
TAGTCTTAGTCAAAAGTTACATGTTGGAATCAATTTTCCCACAGGAAGAATATTGTCAAT
GGGAGATTTGTTTCCCACCTAGTGGAGCCAAGAGCTGCTGGGCTTTCATTCATTCATTCA
GCAGTCGTATTTATTGAGCACTTACTGTGTGCAGAGCACTGTATTAAGCGCTTGGAATGT
ACAATTCGGCAACAGACTTTCCATCTCCAGTCCCCGTTTCCCACAGAGACTTGACTGCTA
GGGCCAAATCGAGACAGGCCATGGAAAGTCCTATAGGAATGGGAGTTAGTTAATCGTGTT
TACTGTGTGCAGAGCACTGTACTATGCGCTTGGCAGAGTACAGTATAATAATAGAACAGA
CATTTTCCCTGCCCTCAATGAGTTTACAGTCTAGAGGTGAAGACAGACATAAATAGAAAT
AAAATAACACATATGTACATAAGTGCTGTGGGGCTGGGAAGGGGGATGAATATAGGGAGC
AAGTCATGGCGATGTAGAAGGACAAGAGGGCTTAGTCAGGGAAGACCTCTTGGAGATGTA
CCTTTAGTAAGCCTTTGGGGGGTGGGGGAGGGAGAGGGATTGTCGGATATGAGGAAGGAG
GGCAGGGCGTTCCGGACGAGAACGTGGGCGAGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved