Ornithorhynchus_anatinus Locus Mono:SNORD22
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SNORD22
Ornithorhynchus_anatinus
Mono:SNORD22
Contig40316
SNORD22
1001..1108
2108
AAAAGCCAGCTTTCATTAGTAATAAAAAAATCAGTGAACAAGTTGTTGTAGTCATGTTA
TTTCTTTTTTCCTGTACTACAGCTGCTATTCCTTCTTCTTTAGGCACACTTCTTTCCACC
ATACATTAGATGGTATGACTGTAGTAGAAACTTTAAAGCCTGAAACCCAAGTCTGAAACA
GACAAGAATGAACATATTCATCAAAGGAATAGAATAGGTGTTTATTTATGTCCTTGTGTA
TGTGTGTGTGTGTGTGTGTGTGTGTGTAATTGTACACATTGCTGAATGGAAGAAAATGTT
ACTATTAAGGATGACTCTCACAAATTTAGAGAATATGAAATATCACTAAATTGTATGCTA
ACAAATGTAGAAAGCCACAGTTTCCATCCTTAGTTTCAAATGTTTTAAATGATGTGAAAA
TACTAAGCATAAAAGAAAAATATGGGAATAGTTGGCACTGCGATAAAAAATAATTAGGGG
TGTTAAAGACTGGATATTAGGAAAAACTCCTAATCTAAATGGAATTATGTAAATTCAGGT
TAACCACCAGTAACTATGAGTTTCTTAATTTATCAAGTAGCAGATCTCTGTGAGGTCATA
AAATTATAAGGCACATATATCTGATCTCAAAAAGAGAACTCTGAAGATGATGGATTTCAG
ATGTTCCTTTAAAGTGTTAATTACCTATCTGGGAGAGCATGGTGATTAAATAGAGAGCAG
GGAGGGAGGGGAGACTTTGTAAGCATTCATCACTCTTCTCCTGAAAACCCTTCTCGGCTC
CTTAGTTCTGTGATGTTTCAAATTTATTCCCCTGCAAATTTCTAAGTTAAAACCCTTGGA
GGATTCACTTGAGCTTTTGCCAGACCTGAACTTTGTTAGCAGACTCCAGGCTCTTCCAGG
AAACCTGCCATGATTGCTTCACAGCAACCTAGGCTTGTCAGCCCAACACTTACCTTTAGC
ACTTGTGAACTTCGTCCCTAGTCTCGGTTCTCATGTACACATGTCTATTTAAACCACCCC
CGACTTAGCCACTGGCCAGTTCCAGAGTCTGCAAAGGCGAATCCATTGGAGCTGGCAGGG
GAGAGAGGAAGAGGAATGCTTTAAAGCACTCCGCCACCTTGCCCCCTCCTACCTCACCTC
ACTTCTCTCTTTCTACAACGCAGCCCAAACACTTCACTTCTCTAGGGCTAACCCTTCGCA
CTATGCCTCAATCTCACCTATCTCACCACCTGACCCCTAGTCCACGTCCTACCTCTGGCC
TGGAACAACCACCCTCCTCAAATCCCAACAGACAATTATTTCTCCCCCTTCAAAGCCTAA
CTGAAGGTACATCTCCGCCAAGAGGCCTTCCCAGATTAAACCACTCTATTCTGGGTCACC
CTGACTTGTTCCCTTTGCTCCTCCCTTTCTCCCAGCCCCACAGAACTTATGTACATATCT
GTAATTTTATTTTATGTATTTTTATTGATGTCTGTCTCCCCTTCTCTAGACTGTAAGCTT
GTCGTGGGCAGGGAATGTGACTGTTTATTGTTGTATTGTACTCTCCCAAACAGTACAGTA
CTCTGCACACAGTAAGTGCTCGATAAATGACTGAATGAATAAATAATGACAATATTATGC
ACTTATTCACTTCATTTATTTGGCTGTTTCTTCCTCATGTGTTTGGACTGATCCGTGATT
GTATCCTGTCTTTCCAACTTTTACCATCAGTAAATGACTTCTGTTGTTTTCCCTCATGAA
ATTTTGAACTCCTTGAATGCAGGGAAACTTTGGCAACCTAGTTTTTCCTTACCCATGTCT
TACTGCTATTGTACTCTTCCAAGTGCTTACTTAGTAAAGTGCCCAGCACCCAAGTACTCA
AAAACCATAGATAATGTTGGCAATCACAGTTGTGAAGACTGTAAAGACTTTCTACCTGGT
CTTTCTTTACTCTGCTGATTTTTATGGACAGGGTTTACTACTTGAAAGTGATCAAAGGTG
TAGCAAACAAAGCTGTGTTCTTATTTGTAGGTCTAGTATCGATATCTGGGGACTTTTTTT
AGACTTTTTTTTGCTGACTACATAAAGAAATTAAGTGCATAAATGGTGCCGTGCTGGATT
CGGCTGGGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved