Ornithorhynchus_anatinus Locus Mono:SNORA24
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SNORA24
Ornithorhynchus_anatinus
Mono:SNORA24
Contig379
SNORA24
1001..1105
2105
CACAACGAGCTCACATTTTTCACCATGGTCTCTCTGCCTTTCTCCTTCTTACTGGGAAA
GGAAGGGACTTTGCCTCTAAATTGCTTGTATTTTTTTTTATAGCTACTCTTTATGTCTCA
TAACAGGCAGCTCTCCTTTGTACTTTGAACATTTCTAATCTTACCCCTTCCCAGCTGGGC
ATTTTACTTTATTCTCTGTTTGAATCTGGCCTAATTTCCATTTTTATAGTTTTTCCTCAC
TTTGCCCGCAGGTCTCTGTTGAGTTCTGGGTTTGACCAACTTTAGTGTTTAATTTGTTTC
CCAGTCTGCTGAGCCATCATTTTGGGGAACAGCTGGGTTTTCCTGACACCTTACTCCTTC
TTAGGGTTTTCTTACATTGAATCCTGCCTATTGAAAGTTCCTAGAGGGAGCAGAAGCGAT
GTCTCCAAATGTAACTTCAGAGTCGCCTATCACATGAAACAATAATAATAATAATGCTGG
TATTTGTTAAGCACTTATTATGTGCCAGGCACTGTATTAAGTGCCCTTAATATTCCCTTG
ATTCTATCATCCCCTTGATTCTATTTATTGCCACTGTTCTCGTCTGTCCGTCTCCCCCGA
TTAGACCGTAAGCCCGTCAAAGGGCAGGGACTGTCTCTATCTGTTACCGATTTGTACATT
CCAAGCACTTAGTACAGTGCTGTGCACATAGTAAGAGCTCAATAAATACTATTGAATGAA
CACTAAGCGCCGGAGAGGATCCGAGCAAATGGAGTTGGACACGGTACCTGTCCCATGTGG
GGCTCATAATCTCAAATCCCATTTCAGATGAGGGAACTGAGGCACAGAGAAGTTTAGTGA
CTTGACCAAGGTGACACTGCAGATATATGGCAGAGCTGAGATTAGAACCCATGACCTTCT
GACTCCCAGGATTGCGCTCTATCCACTAAGTGAACTCACTGTACACAGGGAATATGATTG
TTTATTGTTGTACTGAGCCCTCCCAAGCGCTCAGTACAGTGCTCTGTACAGTGCTCTGTC
CTAGGCATGGAAGAGCATCTGCTTGTTGATGGCAAAGCTGCCACCATTGCATTGGTAGCA
GATTCTGACTTGTGCAAGCGACAGAACTTCTCACCCTGGGCTTCGAGGCTCTCCATCCCC
TTGCCCCCTGCTACCTCTCCTCCCTTGTCTCTTTCTACCGCCCACCTCCTCACCGTCCCT
CGTTCAAGCGTGGCTCAGTGGCAAGAGCCCGGGCTGGGGAGTCCGAGGTCATGGGTTCGA
ATCCCGGCCCCGCCCCTTGTCAGCTGTGGGACCGTGGGCAAGTCACTTCTCTGGGCCTCG
GTTCCCTCATCTGTCAAATGGGGATGAAGCCCCACGTAGGACAACCTGATTCCCCTGTGT
CTCCCCCAGCGCTTAGAACAGTGCTCTGCACCTAGTAAGCGCTTAGCAAATAACATTGTC
AGCTGTGTGACTGTGGGCAAGTCACTTCACTTCTCTGGGCCTCAGTTACCCCATCTGTGA
GAGGGGGATGAAGACCGCGAGCCCCCACGTGGGACAACCTGATGACCCTGTATCTCCCCC
CAGCGCTTACAACAGTGCTCTGCACCTAAGGAAGCGCTTAACAAATACCAACATTATTNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved