Ornithorhynchus_anatinus Locus Poly:SNORD79
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Poly:SNORD79
Ornithorhynchus_anatinus
Poly:SNORD79
Contig37762
SNORD79, snosnR60_Z15, SNORD47, SNORD47, SNORD81
206..283, 436..519, 837..906, 1076..1153, 1302..1367
2367
ccaatcttgcccacttacttgcttatgtggcaagtgtcttaaaatggagactgactgag
cacccctatgtgagacgtggactgtgcacaacctgattagcttgtatctaccccagcgct
tgaacaaataccataaaacagctcacactaaatgttgccttaatgggttgtggcatttgg
atccatgtgtatcactattgtaactgtgctgttcatgatgatttgttaaaatcaatggga
atctctctgaagagaatgaagccagtttttatactgaaacagtacagaaacatacattta
agacaagtgtatctttgaagccacaactaaaattcagtatctttctacaggtgaagaggc
ttatgcccactgaagcaggagcccctaaccagctagcattcaaaggtagcttttttggta
gtctcatatgtttaagccgatacaatgatgataacatagttcagcagatgaaaagtgatg
aactctcatttttgtctttcgctcctatctgatgtatctggctttctgtgaactaaaaat
cagggtttactaaaggctttaggggcaaaacattgtcctccgagcctaccccagtctaac
agagaacatagatgtagagggaatgcagggcagtggtgatttaattactggaccatggat
ataatgggagtaagtaaatcagaaaataaagtgtttgcaatggggcagctagtgggagga
atagcatgcttttgaatgactttccaagatggtactttcatcttgctttaatggttttca
ggatgaagactttcaggaccttttaagcatcagtttaaagtaagtcactggggaggtaac
tggtgatgttgatgattttgcctaatgaaatgcacactgttttcacccaataaactatgc
tgaggttactttgttgtataaaattctgagctggggaatcgttttaagtgcctctccatg
cccaattttagacttctaaaacaatgcccccatgcttttttttccaggggatgtgccctg
gacattcacaatcaggtaagatgtctgattccaccttctgcttgttgtaacttgataacc
aatgatgataagattctgccaaatgaaagagactgatttcacctataaaacgttcctttt
tttattctgaggttactatgcaaaaggtaaagagtaaaattttgtttggactgttgtcaa
tgcacttgtccctctctcctagggtttgtgcagtttggaatcatggggacagctaaaggt
aagactgagtgaagaatgagggtactgcatgggtacaatccacaaatgatgaccacatcc
ttaattgaactctctcactgatatttgatgagaatctaaggtctgatgcaacctagggtg
gggatgatggaatgaagtgctaaaattggatccctaacccctacctatttgctttttcca
ggtcaatctggacttcccctgaaactattccacattcactgtacattttcaaactacaat
aaagaatgattcaaagacttgattgttaaaactcaatttaatgccttagagggaaaaaaa
tgggttaagggggatgttagtaccttaaacttcagagcatttattcggttactgagccat
tatacaatgctttcagctcactgggtttcttaataaggtcatatcactgttcattcagtc
tccttgttctcattcatgaaccacaccctatattcaccctaaccactctggtcattgaat
gcaacaacttccacatttctcccctcaggagggagcaatgacaaggtttgctgggctcag
gcagaacggttttcaaaattaatccatgatttttttttaagagtacctgcttgaagccat
tgcaagctaagcattgagaagtccacctccaaacgtcccagggtagttcaaggcagagac
tggagcccgggtttcttgactacagtagttgcccaatttttttcaacaaggaatcctttg
ccatctgaaactccaataggggagttaactcaatccttgctccccctgagttgcctattc
ataaccactcaaccccttatacatgtcttgatgcttaatgattgacctctgctatggaaa
caaatacatggtttaggaccataGCTTAAAACCTGGTGTCTGTCCCATTTCTCCCCCCGC
CCTCCCCAATATTCCTGGTACAGTTTTGAAATTCACTAATTTAGGTGACTAGACAAATCT
TTATATATCAACTCTTTGGGATTCATTGGGCTTGCCTCTTCCACATCGAGGCCTTCTAGG
CCCTAAAATGTTCGTAGCCACAAGCCATCCCATCCAGGGTTATGCCCTTACCCATAACCC
TTCTCCCTCTTCCTTCTTGAAATACCAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved