Ornithorhynchus_anatinus Locus ENSOANG00000022295
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus ENSOANG00000022295
Ornithorhynchus_anatinus
ENSOANG00000022295
Contig36853
SNORD83, SNORA36, SNORA56
1212..1288, 1617..1750, 4655..4786
8007
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNGTTTCTCTTCTTCCTTAGGCACTGGAAACTCTCACAC
GTGCGTTGTTCCAGAGGCCACCGCTCATTGCTGCTGTCAAGAGGCAACTACGGGTCCGAA
CCATCTATGAAAGCAAAATGATCGAGTATGATCCTGAAAGGAGATTAGGTAAAAAGGCCC
GTTTTTTAGGAGAAATTAACTTAATGGCGCCACAAGATGCATCCCTTCGGTTTCTATTGC
ATGTAGTTCAGAGCCACATGATGAACCCTGAGACGTCACTAGCATACCGTGCAAAGATGA
CTCACATCTATCACCCAAGACTGATGGTTCAAGCTGGGAACGTTGGGCTCGTTTACGCTT
GTGAACTGGGAGGAAATATTCAGCCTTAATTTTCTGTGTCTTGTCTACATCTGCCTAGGT
ATCTTCTGGGTGAGTTGTGAGGCGGGTACGTACATTAGAACCCTGTGCGTCCACCTTGGC
TTGCTGCTGGGAGTTGGAGGTCAGATGCAAGAACTCCGAAGGGTCCGCTCCGGAGTTATG
GGAGAAAAGGTATGTATCGAAGTCCCCTCTTTGCTTGTTTCTAAATTCCTTTTCAGAATC
TTTAAGAAATTCACATCCTCTTGGTATCTCATTCCAAGTGGATAGTGATTCTGTAATCTC
CAAAGTGTTGAGTTCAGGTCAGGGTTTCTCCCCTGTTCTGGTAATTTAACTTTGGAACAT
TGGTAATGGCTAGAGGAAATGAAAGGGTGGAGAGTGTTGCTCTACCCGTTTTTACCACCT
AGCGTACAGCCGTCACTTTTTCCTTATTTGAAATAACTGGGAACCGTTGGTTGAAATGGC
AAAAGCTGCTACTCACTGAGGCTGGGAAGTTTTCTTCCTCCTAACTCTAGCACAGTTTTA
CATGTCCTCCCATTAGAAAGCCACCAAATTTCTCTTGGTTTCTGTTGGCAGGATCACATG
GTCACCATGCATGATGTTCTAGATGCTCAATGGCAATATGACAATAACAAGGATGAGAGT
TACCTGAGGCGGGTCATCTACCCTCTGGAGAAACTCCTGACCTCCCACAAGCGACTAGTC
ATGAAAGACAGTGCGGTATGTTCTCCAAGGCATGTTGATTTAGTCAGCTAACTCAAAAAA
AAAAAAATCCCATAAGGCCGTTGCGGTTGCTGATCAGCCCTCAGCTCCAGGTTTAAATCA
GACTATTTTGATCATTCTTTTATTCCTGGGAGATGAAGGAATTTATGAGGGAGTGTTGGA
TGCTGCTAGTGTGCGTCCTTTTGAATTATAAACTGCTTATATTGATGCCTGGCTCCCCCT
CTAGACTGTAAGCTCGTTACGGGCAGGGAATGCGACTGCTAATTCTGTAGTAAAGTAAGT
GCTCAGCACAGCACTCTGCACATAGTAAGCGTTGAGTAAGCACCACTGATTGATAAAAGT
AGCTGGGCTGTGTCTAGCCTCTGGAATTCCTTTGCACAGAGGGAAGCTCAGTTTTCTGGC
AACCCAGTTTCTCCTCCCCCACCCACCAGTTCCAATAGTGTCTCGTGAGGTAAGGGGGAT
TTATGCTTTTCTCATTTTAATCCACAGGTCAATGCAATCTGCTATGGGGCCAAAATTATG
CTTCCTGGAGTTCTGAGGTATGAGGATGGAATTGAAGTCAATCAGGAGATTGTGGTCATT
ACTACCAAAGGCGAGGCCATCTGTATGGGTAAGAGGACATATTTCTTGTGAACACCCAAT
TCTGCAGTACTCTGCAGTGTCAAATGAGCAGAGATGGTGTTAAGCATTTTTTACACAAGT
TCAAAATGAAACTTAGAAGGCTCTTCTGGAGAACACTTGACAGTTCTGTAAACTGGAAGC
CCTGCTATGCCTAACTGCCTGTGCATTGGGTTAGCAACCCCCCATTAGTGATCGTTTGCT
TTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACT
TAATCTCTTCCATTGCTGTTAACTCATATGTAAAGTGAGATTAAGACTGAGCCCCACATG
GGACAACCTGATTACCTTGTATCTACCCCAGCACTTAAAACAGTGCTTGGTGCATAGTAA
GTGCTTTAACAAATATCACCACAGATACCACAGATGTTATTCTGAGGGTTTGGGGTGGGT
GGGCAGTGTTCATGGGTGTGTATTGGGTGACAATAAGGCAGATGGTTATCCCTCTCTAGT
CTGATCCAGTGTCTCTAGAGGGAGTCAGTCTGCAAAATCAACTGGGGGCCCTGTTTCCGT
CCAGCATCATGGTTCTTTGATGATGGTTTCAGACCTGCCATACATTCCCAAATGAATTCT
GGACTGTATAGGATTATCCAGTGATGGGATTTGGCTTCAAGAAAGTGTTGCATTTTTTTC
CCCCCAGAGCAACTGTGAAGAAAGAACCAGTAACCCCAGTCACTCCAGTTGCTCCAGTTG
AGGTGGCCAAGGTACAGAAGGTGAGTGTCTTTAAGTGACCTCTTAACCGAGCCATTGTCT
TTCAAATGTGGGTGTAGGGCTAGAGCAGGGGTCAGCAATGATTTTTGACTCCTTGACTTG
TTGGAGACATCTACTGGCTGACGGTCAGGGGAGAGACCTGGGTAGCTTGTGGCTACCTTG
GAGACGGATAGATCTGTTCATCTCTAAACTAGGGGATAAAAGGGACAGAAAGGTCACCTG
ATCAATCCTCCTTCATCTAAATACACTTGGGACTCTAGAATGGAGTCAGTCTTTAAAAGG
AAGTTCCATCTCTTCATTGTAGTTACCTGACCAGGCTAATTTTTTTGATTCACGTCTTAG
ATGTAGATTTCTGTGGTGTAGATTTCTGGATGTGGTTGTATCCGTAAAAGTTTAGGGACT
TGCCGTGAGTAAAGTTGAAATACATAAACACCTCTTGGGACAGAGTCCCTAGGTACTTTT
AAATAAGCCTTCCTCAATCATCTTAATGTTGGGATATATTACAAGCAGTAGTGTGAGATG
TTTTTTCAGAACCTGGCACTTTGGGGGTGTCAGCACATGCTATGGGTTGGGTTTTTTTTT
TTTTTTTTTTTTTGGTCTGACCGAATCTATTGATCTGTTAAAACAGAGAAAGAGGGAGAG
CGGAAGTGAAAGTGATGAGGCAGCTCCATCCAGCCCAGTTACTCCAAAATCAGAAGAAAT
GAGTAAGAAGGAAAAGAAAAAGAAGAAAAAGGAAAAGAAGGCTAAAGAAGCAGTAGAGAG
TGGAGGCGAGTCGATGGATGTGGTATGTATTATGATGAAGTGGTTAAGTAGTAAAGTAAA
CTGAAATTAGAGAGGAAACAGGGAGAATGAGGAGGGCCAAATGGTAAACCGTAACACATT
CCATTTGTTATGCACAATTTTTTATATATGCATATATACGTGAACTTAAATGTGGCTGAA
AGTGAAGCCAGTGGTTTAGAAACCTTGGCAAAGAGGGCCACAACGGTACTATTGTAAGCA
CTATCGATTGTCAATCGAGAAAAGTAAGTCTTTGTTGAATTTATTCCTTTCAGGGCAGCG
ATAGTACCAAAAAGAAGAAAAAAAAGAAGAGAGCAAAAGAAGCTGACAGTTCCGAGTGAT
GGGGAGAGATCATCCATCACTGGAACGTATTGTCTGTTTGGATGAAACGAATTTTGAGGC
CTTAACCAAGGGTTCGTTCCCACAGGAATGGGGAAAGATGCACCACAGGAATGGACAAGG
AGGTGGCATGTTTTTTGCTCTGCTACCTAGATTATATAGAGCATTTGGTGGTGTAGTGCA
AAATGGTCATCCCCTCAACATCCTGTTTTAAGGATCTCTGAGGGGCGGGTGAGAAACGTC
CCATGTGTTGGACATGTCCGTTCTTCAGTTTAGAGCAGCTGGAGAAATCTCACATTTTTT
GAAATACCCTGAGTCATCCAACTGCTGCAGCCCGTTGTCACTTTTAAATTTACTGATATT
TTATTGCATTTCCATTGAATGGGAGTATTAAAAAAAGATCTCACCTGCCTCTCTCTTCTA
TTTTAAAAGATTTGTGAGGTAGATCTGCAAAGGTTGTGTTTTTGTGTGAGTTCAGTTTAA
ATGAGCTGAGTCCCTCACGGAAGGGGAAGAGAAAAGGTGATGGGCAGCACCAACCATATT
GTTTCAGGTCAACAAACTATTACTTCTACAGGTCTTTGCAAGAATAACGAACCGGTCCGG
ACTCTTGTATCGAAAGTGACAAAGCAGTTGTCATTTTGGATGATGATGTTTCACTGTCAC
TGTCCTCATGCTTTGTTCAGATCGCACCTCCTGGTGGAAATTGAGGGTCTTTTTTTAAAG
AGCCATTTTAATGCATCCTACAGAGCGAATAGGAATTTACATCAGCTTACTCGTAGTTCT
GACCACGATCTCTCCCAAGTGTGTCGACAAGAATGCACTACTTTTGCATTTGGGTAAAAT
CCTTTATGTCTGGAACTGTCCAATGTAATCCCCTTAGTCTATTTTTGTTCCTGTCCAAGT
CAAGAGGTGGGAAACGGCGAATAATGGTTGTCCCATATAGGGGGAAATTGGTTACAATTT
TTGTTTACTTTTTTATAAAAAAAATAAAAAACCTAATTTGTAAAAATTAGCGTGTCCAGC
TGTTGGGAAACAGTGTGTTACGGTTTTGCTCGATGAGCGGTGTGAAAATGAGGCTGTGGT
TTTCAGTTTTATTCTTGGGTACTTGACACACTTNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1127, 1378..1508, 1911..2054, 2547..2667, 4443..4473, 4543..4613, 4985..5151, 5432..5451, 5535..5721, 5993..7007
1001..1127, 1378..1508, 1911..2054, 2547..2667, 4443..4473, 4543..4613, 4985..5151, 5432..5451, 5535..5721, 5993..6058
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved