Ornithorhynchus_anatinus Locus RPL12
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus RPL12
Ornithorhynchus_anatinus
RPL12
Contig33729
SNORA65, SNORA65
3201..3332, 3822..3952
6399
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNTCCTATAGGGCGAATTCGAGCTCGGTACCCGGGGATCCCACCCGAGGCACACCACCA
AGCCAGGCCCAGTCCAGGCCCAGTCCAGGCCCGGCCCCGCCCGGTCCGGCCCCGAGGAGG
CCGGAGGGCGCCGCTACTGACCGCAGTAGGGTCGGGCCCGCCCCGCCTTTTCTCTTCTTG
CCCACAGCCAACATGGCAGGAGCGGCGTCGCCGCTGCTCTCGCGAGACTTGTCCCTCTAT
ATCCGTCGGGTTGCGGGCGGTTTCCGGCCTCTCGGCGCCTTGCTCGCGGGAGGTGGAGGT
GCAACTTCTCGGTCGTCCCGAATCCGGGTTCATCCGACACCGACACCGGCCCCGCCGCTC
CGGAACCGGCCCGCCGACGCCGCCATGCCCCCCAAGTTCGACCCCAACGAGATCAAAGTC
GGTGCGTCACGGGGTGCGGGAGGAATCTAGAGTGGACGGATGCCCCCCCCAGCCCCGGCC
ACCCTGCCCTCTGGACCTTCACCTCTCCCCCCCCTTTTTTTTTTTTTTTTACCGCCCTGT
TCCCTCCCCTCCCTGGACCCCTTTCCTCCCACCCCCCTTATTTCTGGTACCCGCCCTCTC
AACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNATTTATTTTGTTTAATGAGATGTACATCACCTTGATTCTATTTAGTTGCCATTGTT
TTTTCGAGATGTTCTTCCCCTCGGCTCTAGTTATCGCCATTGTTCTTGTCTGTCTGTCTC
CCCCGATTAGACTGTAAGCCCGTCAAAGGGCAGGAACTGTCTCTATCTGTTGCCGACTTG
TTCATCCCAAGCGCTTAGTCCAGGCTCTGCACATAGTAAGCGCTCAATAAATACTATTGA
GTGAATGAATTGAATGAACAGTTGGACAGTCGCCGCCCAGGCCGCCTCGCAGGCCCCGGC
TCGACCTCCTTCCCTGTCCCCCTATCCCGCGGACAGCCGCCGAGGCCCCACCCGGCCTTG
CTCCGCCTCTCCGACCCCGCACCATCCTGCGTTTGGGGAGCAGAGACCGGCCAAGGGCAT
GGCGCTGCCCCGCGGGACCATTCATTCAATAGTACTTAATGAGCGCTTACTATGTGCAGA
GCACTGTACTGAACGCTTGGAATGTTCAAATCGGCAACCGAGAGAATCCTTGCCCATTGA
TGGGCTCACACTCTAATCGGGGGAGACAGATAAAAACAATAGCAATAAATAGAATCAAGG
GGATGTACATCTCAACAAAATAAGGTAATAAAAATATATACAAATGAGCGGACGAGCACA
GTGAGCCCGCCCTTTTGCCGTCGAGGAATCCGGGGACCCAGAGGAGAGAGGAGGGGAGCG
CCTCGTTGAGTGCGCTGGTATATCCCGCTTGGCTGCACGTGAGTCACGATTGTCTCTCTC
TTTTGTCCTTAGTATTCCTGAGATGCACAGGTGGGGAAGTCGGTGCTACATCTGCCCTGG
CTCCAAAGATTGGACCGCTGGGCTTGGTAAGTTGACAGCCATCATTATTCAGAAATGGGG
TGTGCACAAGATAGCTAGTACCTGTCCCACGTGGGGAGAAAGGGCAGCCTTTCAACCCGA
TTTACAGATAAGGAAACCGAGGCACCAAGAGATTGTGACTCGCCCGGGATCACGTAGCAG
GCGACGGCCGGGATTCCTAGTTCCCTGTGCCCGTTCCACTAGGCCTATGATTGCTTTGTT
CATGTAAGCTTGGTCAACGGTTTGCTGGGTGTCTTTCTGAGGGATACAATCCAAATTATT
TTGGAACCATAAGCTTTTAAAGCTTCTGTCAACTGGTGAAGTGGGCTTGCGTATACGTTA
AAATGATTTAGTGGTATCGAGTGCTTACTCGGTGCAGAGCCCTGTGCAAAACACCTGGGA
ATCTACAATATGATTTGGTAGGTGTAACCCCTACCTATAACGAGCTTACAATCTCTACTG
AGAGAGAGATGTTAAAAAAAAATCAATTACTGATAGGGGGAATGGGGTAAATTTGTCTAC
AGGAAACTGGAGAAGCTTCAAAACCCAGAAGCAAACACCTCCTATGCCATGTTTTTTCCT
AGGTGTACAGGGAGGGGGAGTATAGTTTGTGCTTTGTGACTGTACCTAACCATATCTGTC
TTTATTTCTCTAGTCTCCCAAAAAAGTTGGTGATGACATAGCAAAAGCAACTGGTGACTG
GAAGGGATTGAGGATCACAGTTAAACTTACCATCCAAAACAGACAGGCTCAGGTACTCTT
CTCTCTGACCTTGGGTGAAGGGGGGGAAGCAGCTGGAGGCAGTGGTATGTGACTAACTCA
AGAGGGCAGCCACCCGCCACCACCGCCACTATACCTGTCTTAAATCCAAGTGACTGGTAT
TTACCAGTGGTAGGCTTAGAAGAATCTCCAGCTGTAGGAAGCAGGCCTCTCCTGGCTCAT
GGAGAGCTCTGTGCCGAAAGGCTGGTAACACGACCAGAGCTTTTCAGTTATTTTGGATGG
TCTGAATTGGACCTGGTAAATGATGATTACCACACTCCGGTGCTTGATTGATTGGGCCCG
GAGTTCAACAGGTGCCTTAACTAATCTTTTTGTCTTGCTTCAGATTGAGGTGGTGCCCTC
TGCCTCGGCCCTGATTATCAAAGCCCTTAAAGAACCACCACGTGACAGAAAGAAGCAAAA
AAACAGTAAGTTTTCTCCCCAATTAATTGGGCTATGAGAGTTTATGAGATACCCAGACTG
GATGGCTGTATATACACCACACTGCACACTGAATGTGTTCCCAGTTAAGGACAGAGGTGC
CAAGGTGGGGTGCAGGGAGGGGCATATTTCTTTGATCTGTATGGGGATCAGTGGAAGGGC
AAAGTTCTTCAAGGACTTGGTGGATGGCTTAGACCCTTGGGAAGGATCACTTACCTGCCC
TTCGAAATGAATGTCACAGATACTGTTTTTTTCATTTAGCCACCCGCCACTGTGCCTAAT
CACTAATAACGTTGGTGGGCACAATCCAGTGGTGAGCTGATATAAAACCCCAGCTTAGGA
AACAGGGTTATTCTGCTTGTGGATGACTCTGTGCCGAAAGCATGGGAACAACCCATGGTG
AAACCAATAAATTGGTGAAGGGGTGCAGTCCACTTGCTGGGATCTTTCACCATGTGAGTG
GCATTCTAGGGTCTAACTGATGGGCTGTGGTTTCTTTTCTGCAGTCAAACACAGTGGCAA
TGTCAGCTTTGACGAAATTGTCAGTATTGCTCGTCAGATGAGGCATCGATCCTTGGCCAG
GGACCTTTCTGGTAAGTTAGACAACTCCTGTTCCTCAGAGCTAATAAATAACTGGACTTT
GTTAAGCACTGGGGTTGATTCAAGGTAATTAGCTTGGAGGTGTTCCCTGTCACTCATCGA
GTTAGTCTAACAGTGATTCTTGTTACCACTATCCATGATGGTTCCCTTATCCTCAAAGCC
TTCCCTGATTTATCAGTTGCTTCCCTTACCTTTTATTACAATATCCCTCTCCTGCACTGG
GCTGTGGTCTAGGTGGGAGATAATACTTATAATCATAGTATTCAGGTGCTTGCTGTGTGC
CAGGCACTGTGCTAGGTGCTGGGATGGATACAGGCAAACCAGGTCTGACAGAGCCCCTGC
CCCACCCGGGGCTCACAGTCTGAGGTCACTGAGGCCCCAAGTGAAGTGACTTGCCTAAGT
TCCTTCAAGTCAAGGACTGTGTCTGCTAACTCTTGAAATGTAGTCTCCCAAACAATGCAG
TACTCTGCGCTCTAAAAAATGTTTAACTCCTTCCTTAATCCCCCTGCTCCCAACATCTTT
CCCAAAGTGACCTGACCAGTATTTTAAAGATGAAGTTGGAAAACGTCTGTCATGATCTCC
AGTCCCTCCCTCCTGTCCCCTCTTCAACTCCTCCATCTTTACATTAGTTAAAATCACATC
TCCAAGACAATTTCCCCAATTTTAAAACCTCCTGTCTGCATTGCCTATGCACTTGACCCT
GTAACCTTTAACCATGAGTAATGGAAAGTTGAAACTGTCTACACTGCATGACTTAAAACT
GAGCTTGTACTTGTCGTGGCTCAGACCTCAAGCTGGCAGAACAGGCAGGTCTTATAAATA
TATGAAGATCTGCTCTGTTCTGAATACAGGAAAATGCACAAGCCCTGTCCTCCAGGGCTT
AGAAGGCTACTGCAGCACATAAGGTGAATCACAGTGACAGGCTCTGCTTGGATTTTGGGT
GAGTGAGCCACCTGCAACTTTGACGCCTCTTTCCTTCTAAATCCTAGGAACTATTAAGGA
GATCTTGGGCACAGCCCAGTCTGTGGGCTGCAACATTGATGGTCGGCACCCCCATGATGT
CATCGATGACATCAACAGCGGTGCTGTGGAGTGTCCAGCTGTAAGTTTTCCCCTAAATGT
TCAGTTGGGGTTTTAGGGTCAGAGACCATGTTGTGCTGTTTAACTAATTGGCTTCTTATT
TTTATTTTCTACAGAGTTAAAGCAGCAGGGAAGAGTGGCAATAAATGAACATTTGACAGC
TGTTGGACTCTTCATTTTTCACACCCTGGAACCATGCTGCCACAATAGAAACAAATCAGC
CGTGCCAGCCTGGCTTCAACTTGTGTGATCTGGTTGGTTAGGATATAGCCTGCTGGCCAG
GGCAGGTCCCATCCATTTTAAGTAGGAGGGAAAACAGGTATTGAATGCACATTTTAAGAA
GGAGGTAACTGAGGCACAGAGAAGTGAAGTGAGGCACAGAGAAGGGAAGTGACTTGCCCA
AGGTCACAGCAATTGGCAGAGCTGGGATTAGAACCCAGACCCGTGCTCCTCCTGGAAAGT
GTCCCTCCCTCTCCCTTGCTGCCTTTGGTCAGATGGTTTAAAGCAGTGACTCCATCTGAG
CACCATTTCACTGGGTGGCATGCTCAGGAGCAAATTTAGGTGAGAGGGCCAGAAAAAAGC
AGGCACTGGGCAATACTGGTATTTTGTACCATATCTTATTATCATTTACAGATGGTGCAA
AATGTGTAGCCATCGGTGCAAAATGTGTAGCTATCCCCCATTTGGCTTTTCTGTAATAAG
TCATTTGAAGGGAGAAAGTGACTGCTTGCTGATTGTTTTCTTGTTTCGGTGTGCTATTGG
GTCCCCCAACCTCAGGTCTGTGTTTGAATTGCTGGTGCAGATGTCTCTAAAATATTTTAG
CACCACTAATCAGAAAAATATGCTCTGAGGGTGTTTGGATTATTTCTATAGTATTCTGTA
TGTATCAGGACAAATGACCAGACTCGGTTCAGGAAACCTTGTAGTGCTACTTAGCAGCTA
GTAATGCATTAATATGTAGGTTTCCTGTATTTTAGCCCATCCCTTTTCACATGCCAAATG
GGGAAGCATCTCCCACCCCCTGATTCCCCAGCTGTTGACCCTGAAGGCTCATCTCTCATA
AACCCAACCCTCTTGCCAGTGGGTATGTTTAGGTGGGAAACTGAGAGGATCCTGAGAGGT
CGAGATAACAGGACCAATAAATAGCTCAAAGAGCAGGGAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1140, 2292..2365, 3013..3111, 3463..3544, 4064..4150, 5147..5259, 5354..5399
1104..1140, 2292..2365, 3013..3111, 3463..3544, 4064..4150, 5147..5259, 5354..5359
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved