Ornithorhynchus_anatinus Locus ENSOANG00000020650
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus ENSOANG00000020650
Ornithorhynchus_anatinus
ENSOANG00000020650
Contig32777
SCARNA20
3309..3442
6360
TTGTCCGCCGTGTGACTTTGGGCAAGTCACTTCACTTCTCTGTGCTTCGGTTCCCTCGT
CTGTAAAATGGGGATTGAGACCGTGAGCCCCACGCGGGACAGGGACTGCGTCCAACCCGA
TTTGCTTGGATCCACCGCAGCGCTTAGAACAGCCTGGCACGTAGTAAGCACCTAGCCAAT
ACCGTCGTTATTACTGCCTCACCGGCTCAGGCCCGTGTGCCCGGGAAATGGGACGCCGTG
GCTTGGCTTGGAAGTTAAGGGCCTGCCCGGACCCCCGGAAGCCGCCCAGTGACCATCTGC
ACCCTCTCTTTCAGCATCTCGGCGGTGCAGTGGCTGTGCAACGCCGACAAGAAGAGCCAC
AATCCGGCCCGGCGCCTCTTTCGGTTTTTCTCCTCCCTCTACGCAGCTCTGGTGAGGCCG
GTCTCCCCCGGTCACCCTCCTCATTGGGGGCGGACCGTTCGGGTGCCACGAGGGTCTCCC
TCACCCTCGTGCCGGGGGGGAGGNNNNNNNNNNCTGTTCTGTTGTCCTCTCCCAAGCGCT
TAGTACAGTGCTCCGCCTACAGTAAGCGCTCAATAAATACCATCGACCGACTGACGGAGG
GAGGGCGAGAAGCTGAGAGAGAGGGCCACGAGCAGCGGAGGAAGCAGCGTGACATAGTGG
ATAGAGCGCAGGCTCTAATCCTGGCTCCGCCACTTGTCCGCCGTGTGACTTTGGGCAAGT
CACTTCACTTCTCTGTGCTTCGGTTCCCTCGTCTGTAAAATGGGGATTGAGACCGTGAGC
CCCACGCGGGACAGGGACTGCGTCCAACCCGATTTGCTTGGATCCACCGCAGCGCTTAGA
ACAGCCTGGCACGTAGTAAGCACCTAGCCAATACCGTCGTTATTACTGCCTCACCGGCTC
AGGCCCGTGTGCCCGGGAAATGGGACGCCGTGGCTTGGCTTGGAAGTTAAGGGCCTGCCC
GGACCCCCGGAAGCCGCCCAGTGACCATCTGCACCCTCTCTTTCAGCATCTCGGCGGTGC
AGTGGCTGTGCAACGCCGACAAGAAGAGCCACAATCCGGCCCGGCGCCTCTTTCGGTTTT
TCTCCTCCCTCTACGCAGCTCTGGTGAGGCCGGTCTCCCCCGGTCACCCTCCTCATTGGG
GCGGACCGTTCGGGTGCCACGAGGGTCTCCCTCACCCTCGTGCCGGGGGGAGGCGGCGAG
GACGGGCCTGCCGGAGCCTCCCTCACCCGCCTCCCGCTGGTCCTTGCAGGCGCGAGGAGC
CCGAGCCGTCCTGCAGCTGTACCCCGAGAACGCGGAACAGGTGAGGGGCCCGTCTGCGGG
GCCGGGAAGGCCGGTGCCACAGCGTGACTCGGGTGTGCAGTCTGCTCTTCTGTCTCTGGC
CTGGAATGTCTTCCTTCCTCATATCTGACAATGATCCTCCTCCGCTACAAGTCTCCATTG
AAGGCACATCTCCTCCTCCCCTTTTCTCCCTCTCCCTTCTGCGTCACTCTGACTTGTTCC
CTTCATTCGTTCCCCGTTCCCCCAGCACTTATGTCCATATCTGTCATTTATTGATATTAA
CGTCAGGCTCCCCTCTAGATTGTAAGCTCACTGTGGGCGGGGAGCTGTCTGTTTACTGTT
GTCCTCTCCCAAGTGCTTAGTCCAGTGCTCTGCACACAGTAAGCGCTCAAAGAATACGAG
TGAATGAATGAATCCCTCCGCTGGCTTCTTCACAAGGAAATGGTGGGGGGTTCCCAGAGA
GCGGGGTGGGAAGGCCAGATGTTCCTGGGGAGACCCCCGGGTCCCCGGGTGACCGGCGGG
CCTCGTTGTTCCCACTGAGCTCTGGACACCTGGGATCCGGCCCGGCCCAGCCGGGGAGCT
GCGGGCATCTCGCCCTCCCGTCCGACTCCTCTCCTCAGAAAGCTGGCTGGGGTGAGGCTC
CGTCGACTGATCCCCGAAACTTGCGTGTGTGCCCCCCAGCTGGAGCTGATCACCGCCCAG
GCCATGAAGGCCGGCTTCCAGGGAGGATTGGTGGTGGATTACCCCAACAGCACCAAAGCC
AAGAAGTGAGTCCAGTGTCCTCTGTCCCCTCCCTCCCCTTTCTCCCCGCCCCCCTTCCCT
CCATCCCCCTTCCTCCCGTCCCGCTTCTCCCCAATCCCCCTTCTCCCCCTCCCCATTGTC
CGTCCCTCAGCCCTCGCTGAGCCGCACTCTCGCCCTGCAGGTTCTTCCTGTGTCTGTTTG
CCGGGGTGGGAGGTCCACTGCCTGAGGTAAGGCTCCCAGACTTTCTCAAGGAGTGTCAGG
GCGGGATTAGGGCTCCCGATCCCTGCAACCACCCTCCCCGCCGCTTTGTGTCCCTTGAGG
GAGTCATTTCCCAGCCCTTGGCCTGGCCCCCGGGAGGCTCTGCTGGGAACCAGGCCCGGC
CAGCCTAGGGGTGGGAGATGGGCTTCCCGGCTCCCCGTGGGGGTCTGCTGAGGGAGAGGG
CTGGGCCGCTCCTCACAGCCCCAAGGTGGATCTTGAGCGAGCAGGAAGGGGGCAGCTGAG
GTGGGTCTGCCCTGGCTCGGGTTGGGAATGGAGGACCGGCTGGATGGGAAGATGGAGCCC
GGTGACGGAGGCCGGCTTGGCCCTTCCCATTCCGGCCCCCGGGAGCTGAGGCCTTTTTGG
GGAGGGGCAGCCGGGGCCACGGGCCTCTGACCTTGGGCTCTCGCAGGGCCTGGGCAGTCA
GTGTGCCGAAGGAGAAGAGCTGAAGGAGTCCAAATTCTCCAGAGAAAGGTAGAGGCGCCG
GCCGGGCTCAGGAGCCACTTGGCTCGGAGAGGAGAGGCGGAGGGAGGAACGGAGGTTATA
ACCGGGGTCGGGGAGCGCAGGGGAGCCCTTCCGGCTGATGGATGCAGGGCGTTGGGGAAG
AACAGGACCTGAGTTTGGTTCAAAATACCACCCTGGCCCCCTCTGACCCTGCCCCCGTCA
CTGCCAGCTGTTGGGGTGATGGGTAAAGCGTCCCTCTGCTCCTGCCGGCAATACATTGAC
CCATCTGGGGCTCTCAGAGCACCTGGTCACCAGCCGCTGGTCAGAGAAGGGAGGCTCCGG
TCCCGGGCCGGGGCAGGGTCGGGACCCAGAGCCCGCGGCCCGGGCCCCCACGTCTCCGAA
AACTCACCGACTGCCCCTCGGGACCAGGAGCACGGTGGTTAGGCAGGAGGGTCGGCGGAG
GGCGGGGGCGCGGGGAGGAGGGGGCTGGCAGACAGACACTCCTTCTTCACGGTCGTGTGA
CCTTGGGTGAGGTGCTTCCCCTCGCCGGGCCTGTTGGGAGAAGGGCGAGCCCCACGGGTG
GGGACGGCGGGCTCCCGGCCTTCAGCGGCTGTGGGGGTCACGGGTTCCCCCCCAGCCGGG
GCGAGGGGCCGAGAGCAGCAGCTGAGGAGAATCGTGGCAGCCGCCAGAGCCGGGGCTGCT
GCATTTTCCGGCCTCAGACACGCGACCGCTGGCCCTCCCTCTCCTTCCTCCCGGCCGTCT
TCCCGAAATGAATCCACCACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNGACGGTGGTTATAATCTTAGGTAGTCTACTTCACCTGGAGCTTGACGTTGGG
CGAGTCATTTATATTATATGGGCCCCACTCCTACAGCTGTAAAAGGGGGATACAATGCGT
GTTGTTCTTCCTAAGTGGATCCACCACCCCCCTACCCTCGCTAGCCACGGGCCTGGGACG
ACTTCTTCACTTCTCTGGGCCTCAGTTACCTCATCTGTAAAATGGGGTTTAAGAGTGTGA
GCCCCACGTGGGACAGGAACCGTATCCAACCCGATTAACTTGTGTCTACCCCAGCACTTA
GAACGGTACTGGGCACCTAATAACCTAACAAGTACTATTATTATTTATTAGGTCTGCTCT
TCCCCCCAGCCAGGAAATGGGAGCGTGGGGACTCCCAGGGACTGTTTTGCTTTTAATGGT
ATTTTTTAAGCGCTTACTCTGTGCCGGACACTGTACTGAGCTCTGGGGTAGATACAGGCT
AATCAGGTTGAACACAGTCCCTGTCCCACATGGGGCTCACGGCCGTAAATCCCGTTTTAC
AGACGAGGTACCTGTAAAATGGGAAGCGGAACCGATAAAATGGGAAGAGAAGCGAAGGGA
CTTGCCCACGGTCACCCAGCAGACAAGTGGTGGAACTGGGATTAGAACCCAAGTCCTTCT
GACTCCCGGGCCCGTGCTCTGTCCACGAGGCCACATCTGGGGTACCCCCGACCCCCTTCC
CCCCCTCACTAGGCAGCGGTTCAAGACGGCCAAGGGCAAGTCGGTGAAGAAGAGCCGAGA
CTGGGTGTTGGAGAAGAAGGAACGGCGGAGGCGGCAGGGCAAGTGAGTGGAGGGCGAGTC
CGCGATGGCGGAGGGGGCGGAGGGATCTCTGTCTCCGTCTCTCTGTCTCTCACACTCACG
TGGCCACCCCCCCATCTCTCCCCCAGGGAGGTGCGGGCTGACACCCGCTACACCGGCCGC
AAACGGAGGCCTCGCTTCTGAGCCGGGGCCGCGGCGGGGAGGCGACGCTTGGGCCTCGGC
CTCCTCCCCGCGGGGAGACTCAGGACTGTTCGCCGGGAGGGAGGGCGGGCGGGCACGGAA
CGTGCCGCGGGGCCAACCGGGCCCCGCCCTCGCCGTCGGACCCGACGGAGCGGGAGCCGT
CGCCGGTCTGCCTGAGGTGTCGCTCCTGGCTGGCCGGGGCCCGTTGGCTTCCCCGTCACG
GTCCTTGGTCTCGAAACCCGGGTCCAAGTGGCTGGGTTTGGGTGGGACGGGGACCCTCCC
CGGCCGGCGTTGGGAGGAGGGGAAGGGCGGGAGCAGTGCTTCCCGGTCTCCTGCCCCAGT
GAGGCACCAGGAGCCAGGCCCGGGATGGATACAAATGTTTATTCTACATAAAAATTTCAC
AAAATGGCTGGCTGGTTGCACCGTGAGCTTTGGTGGGGGGGGGGGGGGGAGGGGCGGAGG
GGGCGTAGAAAGAAGGCAACACGGACAGTTGTCACAGTCACTGGGCTGTCGCGGAGGCTC
GGAAGCGGGACGGAGCACGGACACGCACGCACGCACACGCCTGCTGCGAGGAGGGAGGGG
TAGGGCTGGGCAGATGAACCAAAGCCCCAGCACGGGTGGGGGGGAGGGGGGCGAGGCTAC
CCCTTGGCCAAATACTATGTCAGCGACCCCCCTCCCTCGCCCCCCGACACGAACATGGCA
CCTCGATGACGGGAATCCACCACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
N
  Untranslated Region
  Coding Sequence
  snoRNA
309..410, 1249..1299, 1959..2044, 2200..2245, 2686..2747, 5112..5201, 5306..5360
309..410, 1249..1299, 1959..2044, 2200..2245, 2686..2747, 5112..5201, 5306..5360
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved