Ornithorhynchus_anatinus Locus KANSL2
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus KANSL2
Ornithorhynchus_anatinus
KANSL2
Contig3176
SNORA2, SNORA2
10593..10728, 15751..15889
19314
GTGGCAGAAGCGGGATTAGAATTGGTGACNNNNNNNNNNCAGCACTGTTTTAAGCCCTG
GGGTAGATAGACATTGTCCCACATTGGGCTCACAGTCTTAATCCCCATTTTTACAGATGA
GGCAACTGAGGCCCAGAGAAGTGAAGTGACTTGCCCAAAGTCACCGCTGACTAATGGCAG
AGGTGGGATTAGAACCCACGACCTCTCACTCCCAAGCCGTTTCCGCTAGGCCAGAGTGCA
TCCACCCCAGCGCTTAGTAGAGTGCTCTGCACCCAGTACACCCTCCACCATAGTAAGCGC
TCAATAAATCCTAGCGAATGAATTGCCATTGTTCTCGTCTGCCCGTCTCCCCCGATTAGA
CTGTAAGCCCGTCAAAGGGCAGGGACTGTCTCTGTTGCCGACTTGTCCATTCCAAGCGCT
TAGTACAGTGCTCTGCACCTAGTAAGCGCTCAATAAATACTATTGAATGAATGAATGAAT
AAATAGGATGGAATGAATGAACGAATATCAGTGTCCCGGCCCCGCCCACCGCAGGGACCG
AGTTGGTATTTGTTAAGCGCTGACTAGGTGCAGAGCACTGTTCTAAGCGCCGGGGGAGAT
ACAGGGTCATCAGGTCGTCCCACGTGAGGCTCCCAGTTAATCCCCATTTTGCAGATGAGG
TCACTGAGGCTCAGAGAAGTGAAGTGACTTGCCCACAGTCACCCAGCTGACAAGTGGCAG
TGGCGACATTCGAACTCATGACCTCTGGCTCCCCAGCCCGCGCTCTTTCCCCTGAGCCTC
GCGGCTTCTGCCTGAGTCGGGGTCCCGGATGGGCGGAGCCGCGGCCCGACGAGCCACCAC
GTGGGGAGTTTCCCCTCCCGCTCCCCTCAGCCGCGTGACGCGGCCGAGGGGGCGGGGGAG
GGCGCTCTTGATTGACGGCCCACGCGGCCTCTCCCGAGGCGCCCCCTCCTCTCAGCGGCC
GTCGCGCGGGGGCGGGCGAGGGGCCTCAGCCAATGGGAGCGCCGGGCGGCCGGGCGGCCG
GCCAATGAGGGCAGGGGGCGGGGCGGCGGGCGGACTCCGAGGCCGAGCGGCAGGAAGGCC
GGCGGCGGGGCCGGGGAGGTAAGATGGCGGCCGGCGCTGAGGCGGTGGGAGCGGGGGCGG
AGAAGGGGCGGCGAGGGGGCGGCCGTTTTTTTGGGCTCCCGGACCGCTCTCCCGCCGTTT
CCCCCCGCGCCTCCCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCCTTTTCCCCCTTTA
CCCACATTTCCTCCTTTCCCCTTCCTGATTCTTTCCCCCCCTTACCTTCCCCCCCAGTCT
CTCCCCTTCCTCCCTCTCCTCTTTTCCCTTCTCCCCCTTCTCCTTTTCCCCATCTCCTTT
TTTCTTCCCTTTCTCTTCTTTCCCCCTTTTCCTCCCTTTCTCTCCCCCCGTTCCCTTTTC
CCCCTTTCTCTGCCCCTTCTCTCACTTTCCCTCCCCGTCTCTCCCCATTCTCCCCCCTTT
TCCCCCCTTGTCTCTCCCCTTTCCCCCCCCCTTGTCTCTCCCCTTTACCCCCCTTGTCTC
TCCCCTTTCCCCCCCCTTGTCTCTCCCCTTTCCCCCCCTTGTCTCTCCCCTTCACCCCCT
TGTCTCTCCCCTTTCCCCCCCCTTGTCTCTCTCCTTTTCCCCCCCTTGTCTCTCCCCTTT
TCCCCCCCCTTGTCTCTCCCCTGCCCCCCCCATCTCTTACCTCCCCCCGTCTCTTCCTTT
TCTCCCCTACTCCCCCCCCCCCCCCTTCACTCCTCTTTCCTTTAGCTACCCCAACTTTCA
GGCCCCCTCCCCACTGGCATACCCCTTCCCTTCACCCCTGCATAAACCCACCCAGCCCAA
AGATGGAGTTTGGCCTCCTGAGGGCCCGGTGGCACCTCCTGAGCCCAGCCCGCCCCTCCG
GGGTTCCCCCGCAGGTGTTGGCATGAATAGAATTCGGATCCACGTCCTGCCGTCGAGTCG
GGGCCGCCTGACCCCGGTGCCCAGGACCCAGGAGCCCCTGTCCTGCTCCTTCACCCATCG
GCCGTGCTCCCAGCCCCGGCTGGAGGGGCAGGAGTTCTGCATCAAGCACATCCTCGAGGA
CAGAAATGCCCCCTTCAAGCAGTGCGGCTACATATCGACAAAGAACGGGAAGAGGTGTCC
GAACGCCGCCCCCAAGCCCGAGAAGAAGGATGGGTACGTCTTCCCCGATGGGGTTCCCGC
CAGGGACGGGGAGACGGTCCCTTGCCGGGGAGGAGCCGAGAGCCGGCGAGTAACTCGAGG
TGGCCCTTTGCCGCAGCGAAGTCATGAGGTCATTTGGCAAAGGACTAGCCAAGTATTTGA
GGGGAAAGGGTATTAGATCATCACTAGTCACACGAGCTCTCAAGGGGTGAGTTTCTGCAT
CCCTCCCTGGTTACAGAGCACTGGATAAGGGCCTCGCTGGCATTTACGGAGTAGGGGCGA
GACACAGGCCGGGCACAAACTCCAGTAAGGGCAGAGCAAGCTTCTGAATTCACGGCTGCC
CAAAGGACAGAGAGGTTGACTGATCTCCTAGATGTGAACTCTAAGATGCGGGTGGTCCTG
CTTTGTTGTCATGTTAGCTCTGTGGGAGCATAGCATGGCCTAGGGGATAGAACACTGGCC
TGGGAGTCAGAGGGACCTGGGTTCTAATCCCAGCTTCACCCCCTGTCTGTTGTGTGACCG
TGGGCAATTCGCTTCACTTCTCTGTGCCTGTTACCTCTAAAATGGGGATAAAGACTGAGC
CCCATGTGGGATATGGTTTGTGTCCTTACCTGAACAGCTATCTATGCCAGAACAGTGCCT
GACACATAGTAAGTGCTTAACAGATACCATGAAAAAACTGCAACGGTTTCGGAGTCAGGA
CAGCGGATTTGTGAAAGGGGAGGATAAAGTTGGTTCCACATTCCTGTTTCCTTCCTCCTT
CCCCTCCACCCCCAGCCCCAGATGAAAAACAATCTGAAAAAGCTTTGAGCATTTCAATGG
CTAGAGCACAGGCCTGGGAGATAGGAGGTTATGGGTTCTAATCCCAGCTCCACCTCTTGT
CTGCGGTGTGACCTTGGACAAGTCACTTTACTTCTGGGCCTCAGTGACCTCATCTCTAAA
ATGGGAATTGAGACTGTGAGTCCCATGTGGAACAGGGACTGGGTCTAATCCAATTTGCTT
GTATCCACCCCAGCACTTAGAACAGTGCCTGGTAGAAAGTAAGCGCTTAACAGATACTAC
TATTATTATAAAGCCACTCAAGGCTATAAGGCCTCCCTACAGTCTGAGTGCGCTTGAGAT
TAATTACAATTTAGGGAGTTCCTGCTGCCGAGAATATTGATTTTTTCTTTTCCCCCGCTC
TCTGGTGTGGTACAGGCTTTGTAAGCGGCTGAACAGTCCGTTCTACAAGCGTCTGTTGAA
CATCAAAGGGGCTAATAACGTCACACCAGGTGAAGACAGGGCAGATGATTTTGTAGCCAA
ATGTGTTTTCTGAACTTGTTCCAGAAACACGAGCCAAGTAGTCCCCTCTCTTTTCCAGGT
GGGGAAACTGAGAGGTAGGGAAGTTTGGGAATAACTGAGCCGTAGGGAGATGGAATTGTT
CTGTCCAAGGGGGCTGAGGGAAGTGAATATAGCAATCTAACAGACACATTCCCTGCCCGC
AATGAGTTTATAATCTAGAGGGGAAGACAGGCATCTATAAATAAATGTAATAAATATAAA
TAAATGAGAAGTAGCGTGGCGGAGAGGATAGAGCATAGGCCTGGGAGTCAGAAGGTCATG
GGTTCTAATTCCCCCACTTACCTGCCGTGTGACCTTGGATAAGTCACTTCCTCTGGACCT
CAGTCACCTCATCTGTAAAATGGGGTTTGAGACTGTGAGTCCCGGGTGGGACAGGGACCG
TCTCTAACCCGATTTGCTCGTATTTACTCCAGCACTTAGTACAGTGCCTTGCACATAGCA
AGTTCTTAACAAATACCATCATTGTTAGTATTATTATTATTAAATGACACATATGCACAT
AAATGCTGTAGAGCCGGAAGCCTTGTGCTAAGCGTCGGGGAGAGTAGAGTATAGCAAAAA
CGTTCCCTACCCACACCGAGCTGACAAGTGGTCAGCCGGACACCCCCATTGTGTCCGGGG
TTTGGTTTCCTGACTCTCTCTTTGGGGGAGGGGGTGGGGGGTGTGGCCCGCCAGGAAATT
GTTGTGCTGCAGTGACCCAGGAGCGAGAGTGAGAAGGATGTTAGAAGTCGGGGAACTGAT
GATGATCAGGGTGAAACACCGAACACCACCAGGAAAGGGCTGAATCAGATATTTTTTCCC
TCCCCTCCCCATCCTACTGAATTATGATACTTGCTTATTTCTCCTAACAATGAGAGCCAG
TCAGCTGACGCTTATTCCACCTCAGGGAACCGTGAGCCCCAGAGGAATAATAATAACTAT
AGTAATAGCACTTGTTAAGCACTTATTATGTGCCAAGCACTGTTCTAAGCACGGGGTAGA
TAAAAGTTAATCGGGTTGGACACAGTCCCTGTCCCCCATAGGGCTCACACTTATCACCGT
TTTCCCAAGAGGTAACTGCGGCCCAGAGAATTGAAGTGACTTGCCCAAGGTCACACAGCA
GGCATGTGACGGAGCTGGGAGTACAACCCAGGTCCTTCTGACTCCCAGGCCTGGGCTCTA
CCCACTGAGCCACGCTGTTTCTCAGAGGAGCCTCCGTCCCTGCCTTGGACTCATTTCCCT
CACCGCCTCTTAGGTCAGAAAGAGGAAGGAGGTAAAAAATTGCTAATGAGCCTAAAGTTT
TGTGCGCGCCTGTAGGTGTCTCAGCTGGGCACTCCTTGAGATCAAAACATGAAAATCAGT
TGTCATGGCAGTCCAGTTTGCATTCGCCATTGACCAGAGTCTGAAATGAATTAGGTAGGA
GGCTTTAAATGAAATGGGAGTGCTTCATCTCTTCTCCCTGTCCCCAAGAAAGCGTAGCGA
AAGGGGAATTTGTGGGTGAGCACCGGCCTTCCCTGGAGAGGGAGGTCAGGCATCAGTTAA
GGTGAATTCTCACGCTTTGTTTTTTGAATGTGATTAGTGCCGTGGAATAAGAGATCTAGA
CCAGCCCTCGTGAACGGATATGTATGCGTACCGAGCGTGGACTGGGAGCCAGAGGACCCG
GGTTCCCATCCCAGCTCTGCCACCTGCTTGCAATGTGGCCTTGGGCAAGTCACTTTTAGG
GCGCTCGGTCTCCTCGTCTGTAAAATAGGGATTGCCTATGTAGAGAAGCAGCATGGAGCC
CGGGAGTCAGAAGGTCATGGGTTCTAATTCCGGCTTCCCCATTTGTCTGCTGTGCTTCTT
CACTTTTTGGTCCCTCAGTTATCTCATCTGTAAAGTGCGGTTTGAGACCGTGAGCGCCAT
GTGGGACAGGAATTATGTCCAACCCCATTTGCTTGTATCTACCCCAGCGCTTGGTACAGT
GCTTGGCACATAGTAAGCACCTAACAAATACCACAGTAGTTCTTATTTTTAATTGTCCTC
CCTCCCCCTTTAGACTGTGAGCCCTTTGTAGGAAAGAGACCATGTGTGTGTACCTCAGGA
TTGGGCACAGAGTAAGTGCCTAACAAATGCCACAATGGTTGTGCATTGCTGGATTGGGAC
CACTGTACTTGTAAATATCCTTTGTTTGACTCCCACGTTAAAAGTATAAACCCCCGGGCA
GGGATCGTATCATATCTTTATTCTGCACTGCCCAGCACCTCATCCAGGGCACCCCACCAA
GTAGGTGCTCAATAAATCTTACTGCTACCCAAATCAGTTGTATTTATTGAACGCTTATTG
TATGCAGAGGACTGTAAAGCGCTTGGGAGAGGACAATAAAACAGAATTGGAAGACACGTT
CCTTGCCCACAGCAAGATTCCAGTCAACCAACATTATATTCACGAGGGCATTTTTGAAAG
CAGTTGGATTTTACAGCCGTTGCTGGCAAAGTGATCGGATGCTTGGGTCGCAAACTCCCC
GTGGATTCCTCCTGGGAATTTTGGAGGGCTAGAAAGAGAATGTATCGTTTTCTTCCTCTT
TTTGTCCCCAGGGCATCTCTGTGTGCCGAGCACGCCCGCAGAAACGCCCTGGCGCTCCAC
GCCCAGATGAAGAAATCCCACCCGAGTCCAGTGGGCGAAACGCTTTTATGCCAACTGAGC
TCGTACGCCAAGTCCGAGTTGGGTTCCCAGACGCCAGAGAGCAGCCGCAGCGAGGCCAGC
CGGATCCTGGGTGAGGGTCTCCTCGGGGAGCGGAGCGGGGCATTCGAGGGGCCCGGATGG
TCCGCCGGCGGGGGGCCGACTCTTTGGGTGGCGGGGCTTCCTCTCTCCGGTCTTCCCTCC
CCACCTTGACCCCCTGGGGCCAGTTGGATAGTGCCAACTGAAGTGGTTGGGGACCTGCCG
ACGGGCAGCGGGAGCTGACGGCTCTTTCCTCCTCTGTGCCGCAGATGAAGACAGCTGGAG
CGATGGGGAACAGGAACCCGTGACCGTGGACCAGACGTGGAGAGGGGATCCTGACAGTGA
TGCCGACAGCATAGACAGTGACCAGGAAGACCCTCTGAAGTACGTCCCGCCTCCGTCAAT
CATGGGGCGGGGGTGGGGAGCTCCTGTCGAGGGTTGCCGAGGTGGGCGGCCCACAAGGTT
CTGCAGGGGACTTGGGTCCAACATCTACAGCCTCCAGTGAAGACTGTAGAGGAGCAGCAT
GGCGTAGTGGATGAAGCATGGGCCTAGGGGGTCAGAAGGTCATGGGTTCTAATCCTGGCT
CCCCCCTTGTCTGCTGTGTGACCTTGGGCAAGTCACTTGGCTTCAAAGGGACTTGGTTAC
CTCATCTGTAAAATAGTACTGACAACAGTGAGCCCCACATGGGACAGGGACTGTCTCCCA
ACCCGATTTGGTTGTATCCACCCCAGCACTTAGTACAGTTCCTGGCACATAGTAAGTGCT
TAACAAATACCATTATTATTATTATTATTAAAGGACCAGAGGATGACTTCTTAAACTGGG
TCGGTCTCTGGTGCCCTGCTCTGCTTTTTAGCCCCTTCCTCATGTCGCAGGCCTTCTGGC
CAGTGGGGAACTGCCTCACCCCAGAACCCTGGTAAATGCCCTCCCCCTTCCCCCTTCAAA
GTCTGCACAACAATCAAACCTGGCCCAAACCTGACGAGGCCAACAACCTCACAGACGGCA
ACAGACTTTATTCCCTGGCAGTATCCAAGTCTTAAAAGCTTTGCCGAGTCAGAGAAGCTC
TGCAAAGAGCAAATGGGGTAGAAGAGAGTTTAGAGCGGCAGAGCCGGGAAGCCCTTTCCA
TACCCATCCCCTCTCCTGGTCCTGTCTGCTCTCCTCCACTTTAATCTTTTGTCATCCGAC
TCCCTATGGATATCCCCCAGTCCCACCCTGGGGATTTGCAGCAGAGTCTAAAGGAAAGAG
CCCAGAACAGGAAGTTGTGACACCCGGGTTCTAATCCCAGCTCTTTTGCTTGCTGTGTTG
ACTTTAGGTGAGTCGCTTCTCTTCTGGGCCTCAGTTTTCCTCACCGATAAAATGGGGATG
AAAGAACATCTTGCCCCTCGCTCTTTGACAGGGAGTTCTCGTGGTATGAGGATCGTATCC
GACTTGATTGTTGTATTTGCCCTGGTACTTAGCACAGTGCATACAACATAATAAATGCTC
AATAAGTACCATTATTCCAGAATTACTATGGGAACCATAATACCTTGCCAAATAAAATGC
CAATATTTAGGTTTATTTTATTATTATTTTGATGCCTCGCTCTCTAATAATGATAATGGT
TTTTGTTAAGCGCTTACTATGTGCCGAGCATTGTTCTGGGTGCTGGGGTAGAGACATGGT
AATCAGGTTGTGCCACGCGGGGCTCCCGGTCTTAATCCCCATTTTGCAGATGAGGTAACT
GAGGCTCAGAGAAGTTAAGCGACTGGCCCAAAGTCACACGACTGGTAAGTGGCGGAGCCG
GGATTAGAACCCGTGACCCCTGCCTCTACCTTCGAGAGGCTACGGGCCCAGCTTGCTCTG
CTCCTCTTCCCTCCCCGCCCCAGCCCCTCCTGAAGAGCTGACCCGGGTCCGTCTTGCAGA
CACGCCGGCGTCTACACGGCGGAGGAGGTGGCCCTGATCATGCGTGAGAAGCTGATCCGC
CTCCAGTCTCTTTACATCGACCAATTCAAACGGCTGCAGCACCTGCTGAAGGAGAAGAAG
CGCCGTTACCTGCACAGCCGCAAGGCGGAGCACGAAGCCGTAGGCAAGTAGCGGCCCGGC
CCCGCCTCATCCGTCCGTCCGGGGGAGAGAGAGCGTCTGGCGGCCGCCGGCCCCCCGGGG
CGGCGCCGGGCCGACCGGGCCTCTTCTCTCCGGGCTGTCATGACTCTCCAGGTAGCAGCC
TCCTGACGGGCCCCGAGGGCCTTCTGTCCAAGGAGCGGGAGAACTTGAAGCAGCTCAAGT
GCCTGCGGCGGTATCGCCAGCGTTATGGCGTGGAGGCCCTGCTCCACCGGCAGCTGAAGG
AGCGCAGGATGCTGGCCACGGACGGGGCGGCCCAGCAGGTAGGTCGCCGGGCCCGCCCGG
TGAGCGACCCGCCGCCCTCGGCCGTCCGGCCCTCCAACTCGTTCCCCGTTGCCCGCTTAC
CGAGCTTCGGCGGGAAACATCCTGAGGGACCAGCATTGATTTTCACTTAAGGGTGACCCA
GTTGAGAATCGCGGCCCCACGGGCAATTAACGAAACGGCTGGCGGGGCCCCCGGAGAGAA
CCCCAGTGGCCTGGAGGGGCGGCGTGTCTAGTGCAGAGGATGATGCTGGTTTTGTTTATC
TGGTATTTAAGCGCTTACGGCATGCCAAGCGCTGGGATAGACACGAGATGATTGGGCCGG
ACCCGGTCCCTACCCCACCCGGGTGCCCAGGCTAAGGGGAGAGGGGAACGGGTCATTTTT
AGGCCCCTCGTGCCCCGCCCACTCATGGATAATTTTGCCTCAGTGACTGGTGTCTTTCCT
CAGTCAGTCATTCAGTGGTATTTATTGAGTGCTTATTGTTCTAAGCGCTTGGGAGAGTGC
AATACACAGAGTTAGCAGACACATTCCCTGCCCGTGACGAACTTCAAAATTGAGCATTCT
CTCAGTTTGGAGGATGGGTTGCTGACTCATTTTTGGCTCCTCCTTCTCGGCCTATTCCTT
CTAGCCGTTTGGGGTGATTAGTCTACCTGCGAACTGGGGCCCCCGTGGATTAGCGTTCAG
CTGTTCGCTCCCCCGAGGCCGGGCTGGGGCCTGCCGACTCCTGTGCCCTCCCAAGAGTTA
AGCCCAGAGCCCCAAAGGCAGGAAGACCGATTGATTGACAGATTCCGGAGTGACCTCATC
GGAGGGTTTGGAGGCCCCTCGACTCTTAGCGGTCGTGACCCCTCTTCGGCCGGGGAGCCG
AGGTCACTGACCTGTTGGCGGTCTTCATTGTGGCTTAGTGGTTAGAGTACTGGGGGTCAG
AAGGTCATGGGTTCTAATCCTGGCGCCACCACATGTCTGCCGGGTAACCTTGGGCAAATC
ACTTTGCTTCTCTGGGCCTCAGTTACTTCACCTGGAAAACGGGGATTAAAAATGTGAGTC
CCATTTGGAATAGGGACTGTGTCCAACCTGACTTAACTGGTATCTACCTCAGGGCTTAGA
AGAGTGCTTGGCACCTAGTAAGCGCTTAACAAATATCATCATTATTATTTATTATTACTA
TACAGTAAGTGCTTAACAAGTACCGTAATTATTATTACCATCTCAGGCTCACACCACCCG
ATCCAGCCAGAGGTGCTTGGCCTTCGTGGATGACATTCGCTGCTCCAATCCGTCTCTCCC
GATGACCAGACACTGCTTGAACCGTATCCTTCCTCTCACCAAGTCTTCCCGGTCCAGCTC
CCCCCCCCCGGCGACTGCGGGAGCGCCCACCCCCCGGCCCTGAATCAAGGCCAGCGGTTT
GATGGAGCCGCTGGTTTCAAACAGGAGCCTAAAGAAACGTCTTCCACTGGTCTGTTGGCT
GTCCTAGTCCCCGAGCGGGGGGCGGCCGATTCGTTTGGAAGACACAGCCCGTTTTCAGGG
GGCAGCTTTGGAGAGTCGAGCGTATTGGCAGAGCGAGGGCGAGAGTTATTCGATCGTATT
TATTGAACACTTACTGGAGGCAGAGCACTATACTAAGTGCTTGGGAGAGTACGATAGAAC
AGACACATAAGCGAGACGTCCCTGATTGGTCACCCGCCTCCACCCGCTTCGGAGGGAGGA
CAGGCGGCAGATACGTAAAGGGCGTATTGTGAGGATCTCGGTCCCTGAGGAGCGGCCGTG
GTCCAGTGACGTGGACCAGACTAGCGGAAACCTCATTAGTTACCACCCCTCCCTAACTCC
CTAACTCGAGAGGGGGGGGTCCTCTCGAACTTTTGTCCTTCCGGCAGCCTTCTTGTCATT
CGCTTGACCACGTCCCCACAGACATCTGTCAGGATACCAACCAGGTACTCTTCAAGTGGT
GCCAGGGCTCAGAGGCGGCGCCCTGCAACAAGCCGGTTCCGGTCAGCCTCTCGGAGGACC
CCTGCTGCCCCCTGCATTTCCAGCTGCCCCCGCCGATGTACAAGCCTGAGGAGAGCCTGT
CCGTGTCGGAGGAGCTGGGAGGCGTCCCTATGGATCTGTACCTGAGCGCCGCGGAGCTGC
AGCCCTCCGAGAGTTTACCCCTGGAGTTCAGCGACGTAAGTCCCAGAAGCCCCCGGGTTA
GAGCGGGCCAGCCCCGGGCGCCTCAGGCACACAGATCTTCGATTCTCCCCGCCGCACTCT
TCCTTGGGGATCTTCCTGGGGGCTGGGTCGAGCTCAAGTCGTCAGAGTTGTCTTGTAGGA
CCGAGAGAAGAGCGGGGTGATGGGTGTCAGCTGCTCCCGCCAAGGGCAGCAACACTCAAC
CTAAAGCCAAAGGCCTTGGCCCTTTTCTAGGACTTGTAAATGAGTAGTTAAGGCTTCGCA
CTCAGAGAGGATGGCCCAGTAGATAGAGCACAGACCTGGGAGTCCGAAGGTCAAGGGTTC
TAGTCCCGGCTCCACCACTTTTCGGCTGTGACCTTGGCAAATCACTTCTGTGGGCCTCGG
TTCCCTCATCTGTAAAATGGGGGTTGAGACGGTGAGCCCCATGTGGGACAGGGACCGTGT
CCAACCTGATTACCTTGTATCTACCCCAGTGATTAGAACAGTGCCTGGCACATAGCGCTT
AACAAATACCATCATTATTAATATTATTCCTGGGGTAGGATGGTGCGACTTGGTGGGCCA
GGGACTTGTGCCGATATCCCGCCTGCGCCTTTGGTATCAGGAGCCGGAAACTCCCCGGAG
CCCAAGCAGAGAACGGGACGGCGGGCAGGTGGGCAGGGCGCTGGGCTCAGCTCAGCGATT
GAGCCAGAAGAGGGCAGGGTGTAGAGGATAATAATGATGATAATAGTATTTAAGTGCTTA
CTATATGCCAGGCACTCTTACTAAGTGCTGGGGTGGATACAGGCAAATCAAGTTGGACAC
AGTCCCTGTCCGATGTGGGGCTTACGGTCTCAATCCCCGTTTTACGGATGAGGTAACTGA
CAGAGAACTGAAGTGAATTACCCAAGGTCACGCAGCAGAGAAGTGGTGGACCTGGGATTA
GAACCCATGACCTGCTGACTTCCAGACCCGTGGTGGGTGGGCTGGAGGCAGGGCATTGAT
GGGGTAGGGGTGTCCCACAGCTCAAACCGGTATTCGTGAACCTGTCGAGCTCCCGAGGCC
AGCTTTCCGTTCGGGGCCGGGCATTGGATTGACGGCAGAGGGGAGGAAGTGACTATTTGG
GGTGGGGGGAAGATGTCTCACTGGAGGGCTGCTCAACTTCCCCCTGCTGGGTGGAGACCT
GGGACTGTAGGCATGGGACGGGGCAAAGGATGTCGAAGAGAGCAGCGATGTCCAGAAGAG
TTCATGAAGTCTCCCTCCCCGACCCCTACCTTTCCTCTGTTTTGGCTGAGGGCAGAGCTA
GAAAGGCTGGGTTGAAACTTAACATGCGACCAGAGGGCACTTCATCAGCAAGAAGTGTTT
GCTGAGCCAGGTGCATTTTCCAAGTTAGATATGGCCTCTGTGGGGAGGGGTGAACAGCAG
GCTCCAAGTCAGGGTGCCAAGGGTGACTGTTTGTCCCTGGCTTAGTGGATAGAACACAGG
TCTGGGTTCTAATCCCTACTCCTCCTGTAGACCGTTCTGGGATCTTGGGCAAGTCACTTT
GCCTCTCTGTGCCTCAGTTACCTCATCTGTTGAATGGGCATTGAGATTGGGAGCCCCACG
TGGGACAGGGACTGTGTTCAACCTGATCTAGTATTCCCCCCTGCCCCCCAGGGTTTAGTA
CAGTGCCCGGCACATAGTAAGCACTTAACAAATACCATACTTTTTATTATATATGTGGGT
GGGGTGAGCTGTGATCTTGGGACCGTCAGGACACCCCCCTCCACAGGAGGGTGGGAGGGA
GCGACTCCAAGAGTCACTGGCTCTGTTCCGGGGATTTGATCGTGGCTGTCGCTGACACCA
GAAAGTCTGGAGGTGATTTGAGAGCCTGGAGGTCCTTCCTGGCCCAGTGTCCCTTCTTCC
ACTTTCCCTGGGAAGAGGGGAACTCTGCCCCGCCGCTTGCTTCGAGCTGAGAAACTCAAA
CCAAACCACCTTGAAGATGAGCTTTTGTTTCTTTGTCTCCTGTTTCCTGTTTTGAACCAA
GTTACCGGGCTCTGCTCCTTTGTTGCTGTTGAGTCGGTTGGAGATTCATGCTCTGGGGGT
CTTTTTTTGAAGCGGTTTTGGTGTCCCAGAGAGACCCCACCCCTGTGGCTCTTGTCCTCT
TGCTCCCTGAACAGCCTCTTGGAGCATCTCTGTTGAAACCAAGAGGTTCTGTGGAGATGG
GAATCCTCGGGGAATTAGTCTTCCTCCCCCAGAGGAGGAAGTGCATAGAACAGTATTTAG
CACATAGCAAGGGCTAAGCAAATAACATCATTTTTAACAAATACCAGGGGGTCGGGAGGA
CGAGGCCGCTCAGGCGGGCACTGGGGCTTTTCTTGGCCACTTGCCCTCAGCCTGGGGCCC
GACGGGCCTGGCTTAGTCCGCGGAGTCGTTATCCTCCCGGCCCCACCCTGGGATTGACGT
CCCGTCTGCTCCTCTGGCTTCTGTTTACCCCTCTGCTCCTCCAGCCAGATGGCTGGCTGG
CTAGCGAGACCAGCGGCCGCCCAGCAGGCCGGCGTCCAAGCAGCCTATTGTTATCGGTCA
GGCGATGAGCCCGGCCTGGGCTCTGTTGGCGGGAGTGAGCTGGGCCAGCCCCTTGGGCAC
GGGAGACTCGGAGAAGCTGGAGCCGCCTATTCTCCCCGGTAGCGGCTCCCTGCCGGGCCT
CGGCTCGTTGTTCCGTTAGCCACCCGAGAGGCCGATGGGGTAGGGCCAGTGGGGTTACCG
GGCCGGGGGTCACGCGGAACGCCGGCAGTGGTGGGGCCCGGCTCTGAGAGGGGGACCTGA
GAGATGAGTTTCGACCTTGGCAGAAGTGGGTTACGGAGAGGGATATTGAACGAGGTACAG
GACTGCCCTGGTGGAGTTGGCTAGCTGCCGGCACCCCTGGGGGTGATGGGCGGGGGATGG
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNACCCTCCCCTTTTCCCCAGGAGGGTATGAACTCCCATACTGGCTTGTCC
CATCCCTCCGCCGACACTGAGGGCTTCCAACCGGAGCTGAAAAGACCCAAGGTGGCGGCA
TCTGGCGGGTTGGCTCCGAGCCCTCGTTCCCCTTAAAATCTCGGCCTCCCCCCCAACTCC
CAACAGCAGCTGCGTGGGGAGTCCCGCTGACGGGCTGCCGCCTGATGTCTCCTTCCCCCA
AGGACCTGGACGTGGTGGGGGATGGGCTGCAGTGCCCTCCATCTCCCCTGCTCTTCGACC
CCTCTTTATCCCTCGAGGAGCGCTCGATCCGCGACGTTAGCGAGGCCCCGGGAGACATCC
TGGCCAGCGAGGATCCCCCGCGGTCGGGCGGCGGAGGGTTTGCCTCCGGTCACTGTGGAC
CTCTGGGAGGACTGGCGACTCCCCAGGTAACGCTTGCGTCAGGGGCCCCGGAGCTGGGGG
GTGGTCTAGGAGTGAGGCGGAACCACTCAGCAGTGGGACTGTGGTACTGGGAGAGCAGAG
GAAGCCGCGTGGCCTAGTGGAAAACAGCCCGAGCTGAGGAGTCAGAGGACCCTGGGTTCT
TACCAGCTCTGCCACTTGTCTGCTGTGTGACCTTGGGCAAGGGACCTCAGTTCCCTCATC
TGTAAAATGGGGATTATATCCTACTCCTTCCTACTTAAACTGGCAGCCCATGTGGAACAG
GGACCGTGTCCCACCTTTCTATTATGTTCCTCCAAGAGGGCTTAGTACAGTGCTTGGCAC
AAAATAAGCACTAAAAGGGTCGGGGAGGCAGCATGGGATCGTGTCCTACTTTGATTTCCT
CCTCCACCCCCATCTGGGCTCGTGTGTGCATACACACAAATATCCCATCCCAACCTCACG
ACTGAGCTTCGGGAAGGGAGGGGCCGGGACCCAGGCCCTGAATCAAGACCAATGGCTTGC
TGTGGCCATTGGTTTCAAGCAGGAGCCTAAAGAAAGCAATAGCTCCCTGTGGTCTGTGGC
CGCTTGAGACCCCCAGCAGAAAGTGGCCTATTCGGCTGGGAGAAACAGTTGGTGTGGAGT
GGGGAGGACGGAGGCAGCATCGGCTCGGGGGATCGGGGGAATTGGGAGCCTTCAGCTGCT
GCAGAGAGCAGAGGTCAGGGCTGCTCAGCCTGCGAGGGTGACCACAGAGCAGCGGTCAGC
GCCTCCAGGGTGACCAGGGCCTCTCTCCACACAGACCCGAAAGCCGGGAGAAGCCGTGGG
TCCCGCTTCGTTTCCCGGAAACCCGAGGGGCTGCTGCCCAAGGAAAGTCGGAACCCTCTT
CTCTACGCTGCTCGTAGCCTCGGGTGGAGCTGAGCTGACTCTGGTGGGGAGGAGCCCCCA
GCCCCGCCCCACCCCCCCGGGGGCACCGGTGGCACCGACTTCCCAGCACAGAATCAGCCC
GGGGCGCTGTTCCTTGGGCTATTGGGCTACAGGCCTGTCTGCGTCGTCGGTCTGAACCGC
TGAGGCGTGTGGGGCGGCGGGCAGGCCGGCCGCCCGTAAGAGCTGGGGAAACGCGAGAGG
GATGCCCTTGTCGCCTCTCCCCCCGGTTCCTAACAAAGAGGGAGCCGTCTGCCTTGTGCC
ATGTGCTGCCCATGCTCGAAAAGTGTCCGGGCACAAGGTCCCAGCTGCCGAAGTGGGAAG
GAGGCCTTTTCATTCCGGGTGCAAAGAAAAACAGGCAATAAACCTTCGTTAAAGCAGAGG
TGTGTGTTTGGGAGTCCTGCCTGCCCCCTCCCACCCACCCTTCTCCCTCAAGGTCCGCTG
AGTTGGTGCACGGGGTTTGGAGCTGTCACAGGCCCGTATCTGAGGGCTCCCCTGACCCTT
AGCGGGTGCTTCAGTCCCTAGCACGGCCCTTCTTGGCCTGGGGGCGGGTGAGGCGTGGTC
AATGGAGCTGTTGTGGGCGTCGGAGCCACCGCCGTCTTGCTCCGGTCGACCGAGATCGGA
AGGGACTCCCCGGCCCACGGAGAGCACGTGGGCCTCCCAGGCTGCCCTGCGGGGGTGACC
GCACCGGGCCTGTACCCCCGGGGAGAAAATGAAAGCAGCAAGGAGTGGCTCTTTACTTGG
GACCGTTGTTTTCCCATCCAGGTTGGTGGGGAGTGGTGGTAGTTTAGCTGGGGAGGAGAG
GGCCTTGTGGGCCGAGTCAGATGGCGGGGGCAGGAGGGGTCAGGAGGCCCGGCGGCACAG
GCCGTCTGGGTGGCAGCCGACAGTCCCCTCTTGTGACCTCGATCCCCCCCCCCGGGGGGG
GCTGGCTTGTAAGGAGAGTCGGCTGCCACCTGGCCCTAACTCAGCCCCGGGGCCATCGGG
ATCTTTCTTCCCCAGACGCAGCCCAACTTCAAATCCAGGTGATCCGGAGGGAGCCCGGCC
TGGAATGCCAGAGCCCCCCCGCCCCTCGCTGGTCCCCCAACGGCCAGTCCAGCCTTAAGC
TGAATTTCGGTGCCCTTTCCCACCTACCCCGTCTGTCACCCCAATTCCAACCCTTCCCCT
TAGGAGAACATCTGTCTGGCTGATACCGACCCCTGAGGCCGAACCCTGTGCTAGGCAATG
GAGGTGGGTGGAGTCACGGCCCTCCTGGAGCTAGGGATCTAATGTCAGGGTGGGCGTGAG
TCAAAGTGGAGCGGAATTTATTGAACCTTCAAAAAAAAAAAAGCACAAGAATGAAACATT
TAGGAGAGGAGGTAGGTAAAGAGCCCAGGATAGGGTCATCGATACGTCAGGTGACAGCTT
CTGGACAGGAGGCAGTGTGGCCTAGTGGCTGGGGGGCGGGGAGGACCTGGGGGACTCAGA
AGGACCTGATTGCATGCACACTGTGAGCAGAGAGCACTGTACTAAGTGGGAGAGTGCCAT
GGAGTGGGTAGACACTCCCTGTCCTTGAGGAGTTTACATTCTTGGTGAGACAGACACTAC
TAAAATTAGTCTGGCGAGAGGGACACCCCCTGAGGGTTTTTAATTCACTGCGCCTGGCTG
ATGATGCAGAGGATGGGTTGGGCATACGCCAGGGCCAGAAATCATGGGCAGAGGGGCCAG
GGAGACTGCCGCCACCTACCCCCAACTGCTCCGGTAAAGGGACGATGGAACCCAGCCAAC
TTTACACCTGGGTCCTGGCGCTCCAGAGGGCCGTCTTGGGTGTGAATGAGGCTGTGCCCA
GCCACACGTCAAGCTCCTCAGAGAGAACTGGGGCAGCTGTGCCCATGGGGAGAGGGCTGA
GGCAGCCGTGTCTCATGAGAAAAGTGGGGTAACTGTGCCTACTTAGGGGTCGGGCAGCTG
GGCCCACTGGGAGGGGAGGGGGCATAGCCGGGTACTCCAGTAGAGAACTAAGGAAGCTGC
GCCCTCCAGGAGAGGGCTGGGGCAGCACTCAGTAAATTATTGATTTATTTGATGATTAGC
TCAAACCCTGACCCCCACAGAAGGCCACACTAACAGTCATGATTTAGATGCTTCTATCTC
ACATCTCACTCAGCCCCTCCCATCTTTTTTTTAAATGATATATATTAAGCTCTTTCTATG
TGCCAGGCACTGTACTAAGCGCTGGGGTAGACACTAAGGTTGGACACAGTCCATATCCCA
GATGGGGCTTGCAGCCATTATCCCTGTTTTACAGATGAGGTAACTGAAGCACAGAGAAGT
GAAGGGACTTGACCAAGATCACACAGCAGACAAGTGGCAGAGCTGGGATGAGAACCCAGG
TCCTTGTGACCTGTCGTAGCCATTAGGCCACAGTGCTTCCCCTCAATATAGCCATGCCTG
AGTCAGCACCCTGCTCTCCCCACTCCCATCCTTATCTCCTTCTCCAGCCCACCCACCTCC
TCCTTGAAGGCTTCCTAGATCAATTCCTCTGCCCTGTTAACCACCTGGCTCCTCCCCTTT
GCTGTTTGTCTACACATGCAGGCTCGAGCCTGGGTTTCCATTACTGAGATCTTCCTTTAA
ACCCATCTCGCATTCCCCCATTTGAGTGATTTACCAAGGGGCCAGGGCCTAGGGGTTAAA
TCAATCAATCAATCAATGGCATTTATTGAGCACTCTACCTTGCGCTTTGGAAGGTACATC
GTTCCTGGCCCACAACGAGTAAGTGCTCCATAAATACCACCAATCTGAGTTCAGTCATTC
AATTGTATTTATGAGGCACTTACTGTGTGCAGAACACTGTACTAAGTGCTTGGAAAGTAC
AATTCAGCAATCACCGTGCTCCCCTGGGTCCAGCTGGGCTGCCCACTGGTTACCAGGGTG
AGATCTGCAGCCCACCCTCCTCCGCCACCCCACACCCCCACACTCGCCATTCCCTTCTGC
TTATGTCTCTCCATCGTGGCGGCCCACCCCTGGGGCTCCAGCCCAGGCCCGCGCCCCTGG
CCCTCCCCCACACTCCACCTCCCCGACCCGAGACTCCAAATAAAACATTTTCCTTGAAAA
TTCCTTTCCCTCCTCATGTTTCCTTCCTTTTTTTATCCCGAGGGGGGAGGGGGGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1097, 2594..2852, 6731..6909, 7124..7238, 8759..8922, 9051..9217, 10426..10522, 11121..11374, 15062..15265, 16054..18314
2602..2852, 6731..6909, 7124..7238, 8759..8922, 9051..9217, 10426..10522, 11121..11374, 15062..15265, 16054..16314
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved