Ornithorhynchus_anatinus Locus NCL
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus NCL
Ornithorhynchus_anatinus
NCL
Contig30838
SNORD82, SNORD20, SNORA75
3019..3090, 6192..6269, 6741..6875
8945
TGAGGAAAGTAACATAGTGTAGTGGGTAGAGCATGGGGCTGGAAGTAGGAAGGGTCATG
GGTTCTAATCCTGGCTCTACCACTTAATTGTTGTGCCATCTTGGGCAAGTCACTTCACTT
CCGGGCTTCAGTTACCTCATCTCAAATGGGGATTAAGACTGAACCCCACGTGGGATGTGG
ACTGTGTCCATCCTGATTGCTTGTATCCACCCCAGTGCTTACTACAGTGCCTGGCACGTG
GTAAGCTCTTAAATACCACAATTATCATTGATAGGTAAGCAAGATTCATGGTCTTTGAAG
AGGGCTTCTTGACTGTGGGGTGGGGGAGAGGCTTGTGGATGGGGAAATGAAATATGGCTT
ATGGGTCATTATCATTTTTATGGTGGAAGTGGCTGGGGTGCCTGATAACCACTTGAGCTG
GCCGCAGGTGCAGTTAGCAAACAGGGTACACTATGCATCCTCTCTCTGGTGGGAGCCAAG
GCCTGCAGCAGTTTCTAGTCTAGAAGTGGTAAGATAGGAGGTCGTTAGCTGTTGCGTGGA
TGTCTGGTTGCTCCATTTACTTTAATTATAATAATTTTTATGATATTAATAAGCTCTCAG
TGTGTCAAGCACTGTTCTTAGCTCTGGGGAAGGTCATATTGGACTTACTCCCTGTCCCAC
ATGGGACTCCCAGCCTGAGGAGGGAGGTTTGAAGCCCCCTTTTACAATTGAGATCTGAGG
GGGCTGAAGACAATAACCCTCTGGTGGTATGTACCCCATAGGTGGGTATGTGCTAGAAGT
ATTTAGAGAAGTACCTGCAAAATAAAAAATTTGAAGGGAGCCTTCAGTTGGGAAGGGAGC
TCCTTGGCAGGGTTAGTACAGTGTCAACATATTAGAGATTGAAGAACATTGCAACGTAGG
GCATCTCTTGCTGCACATTCCTACTTTCTAGTTCTCAATTCCAAAAGTAATTGTCACTGG
CTCTGTCTGAGGGCCAAGGACCAAGCCATCATTCTGCATTGGGAAGGTTTTCCCCAGTAT
GTGGGAGAGGGTGGGTATTAACTGCTCATTAACTCACCCCTCCAAGACCCAGTTCCCCCT
TAAAACGCTGGTGCTGTCTCTGGATAACTAGCCTCCATGGACATCCTCAGGGATATGGTC
ATTCAGTTATATTTATTGAGCTCTTCCTGTGTGCAAAGCACTGCACTAAGCCCTTACAGG
GCTGTTTTCCATGTTCTGAGTTAATAGGACTTGAGGAGCGCATTCATTTTTATCATTTCT
GCTCCTTAGGTTGTTATCCCTCAGAAGAAGGCAGTGGCTACACCAGGGAAGAAGGGAGCT
GCCGCCGCCACCCCAGGGAAGAAAGCCATGGCCACCCCAGGAAAGAAGGCTGTGGTGTCA
CCAGCCAAGAAGGCCGTGGTGGCCACCCCTGCCAAGAAGGCAGCTGCAACACCGGGCAAG
AAAGCAGTCGCGGCTGCAGCCACCCCAGCCAAGAAAGCAGTCACCTCTGCCAAAGCAGCA
CCCACCCCAGGGAAAAAGGGGGCCGCCCCCGCCAAAGCAGCACCCACGCCAGGGAAGAAG
GGAGCCACCCCGGCCAAGGGGGCCAAGAACGGAAAGAACGCCAAGAAGGCTGAAAGTGAG
GAAGAAGATGAGGAAGAGAGTGAAGACAATGACGACTCTGAGACTGAAGCTTTGAAAATA
GTTGCACCAAACAAACACGACGATGAATACGATGAGGATGATGATGATGACGATGACGAT
GATGAAGATGGTATGGCTTCTGCCGGGTGGCGGGGGGCTGTTTCTTAGCTTGCCGGTCTG
AAGGAATTGAGGGATGAGTGTCTGGCCCCAGCATCCTTGGAGCAGGAAAACTGCAGGAGG
AGAACTAGCTGGGCTTGAGGGGTGGAAAAAAGTGCTGTATAGCAGACGGCACTGTCAGAA
ACAAGATCAGGAAAATGTAATGAGCCTTCCCCTTCTTGAGCAGTTTAGTACAAAATTATA
TTTTACTTAGCCATCCTTGGATTTGCTTGTCACTTATGGATGTTTTGTTTTTGTTTTTCT
TTTGTCTCACCGCCGCCCCCCAGACTCTGAAGAAGAACCCATGGAGATCACACCAGCGAA
GGGAAAGAAGGCCCCACCTTTGAAGGCTGCTTTGAAAGCCAAGGTGGAGTCTGAGGAAGA
AGAGGAGGAGGATGAAGATGATGGGGATGAGGAGGAGGAGGAGGAGGATGAGGAGGGTTT
GTGGTCCTTGGTTAATAAACACCATCATTATTATTAACATGAAGTTGGGTATATTCTTGA
ACTGAGCACTATCCCACTGCTCTGCACACAGCAAATGCTCAGGAAATACAATTGATTAAG
GCAAGGAAAATAGCTTGATATTAACTTTTTGGGGTTATGGGCACATTAGGCATCATGACA
ACATTTGTAAAGCATTTACTACATAACAATCTACGTAAAATGTTACGTACTACATAACAA
TCGCCTGCGTAGAAACAAGTTAATCCGATCAGAGTTCCTGTCCCACATGGGTCTCAGTTC
AAGAGAGTGCGAGAACACATAGCTAATTCCCATTTTTACAGATTTTCTGTTTATTTCTGG
GATTTTTTTCTTTTTTGGTATTTTGTTAGAAACACTTATATGCCAGGCACTATACTAAGC
ACGGGGATAGATTCCAGATAATAGTGTTGGACACAGTTCCTGTCACTCACCAGTCTGAAT
CCTCATTTTACAGGTGATGTACTGAGTCCAGAGAAATTGAAGGGACTTGCCCANNNNNNN
NNNCTCTTACCACATGAGGGTCTTGGTTTTATTTATGACAAAATCTAACTTGTGGAAAGA
AATTTAAGCTACACTTTGTTTTGCTCACAGAACCTGTGAAAGAAACACTTGGAAAACGAA
AGAAAGAAATGGCCAAGCAGAAAGCTGCACCAGAGGCAAAGAAACAGAAAACTGAACGTA
AGATTTTTTTTCCCCCCTCTACCTCCAATCTCAAATCCCCTTCCCCACTTCTAGACTGTA
GACTACCCCTCTCAAAACAAGCACAAATGATGAGCCTAAAGGGACTTAATACTGAAACCT
GATGTAACTAAATAATATATGCTGATCGTGCTGTAGTTTTTGCAATATAAACCCTCTTTA
TCACTGTTTCTCGCTACCTTACTAAACATGCTTTTCTCCCTGTTCCCTCTTGGTTAGCGA
TTGAACCTGCATCAGCTTTCAATCTCTTTATTGGAAACCTGAATTTCTCCAAAACTGCTC
CAGAGCTGAAAACAGGCCTCAGTGATTTCTTTACCAAGAATGACCTCACCGTTCTGGATG
TGAGAGTTGGTGTTTCCAGGTGAGTTTTTTTTTAATTGAGGAACAGCCAGTTCACATGGC
ACGATTAACCAAACTTTGTGGAGAATCTTATACCTTGTTAGGATGTACTTAGTATACCTA
GTTCTGGTTCCTAACCTGAATGTTTGGCATTTTTTTCCCTTTCCAGGAAATTTGGCTATG
TGGACTTTGAATCTGCTGATGATCTGGAAAAGGCCCTGGAATTGAATGGCTCTAAGGTCT
TTGGTAATGAAATGAAACTGGAGAAAGCAAAGGCAAAAGAGACAAAGAAAGGTATGAATA
TTGGGGTCCAAAGTTGGCTGTGCTCATTTTACAGTACCCGCCTTCCTCATTTTTATTCAT
GACTGCATCAAACATTTTTGCTTGGTTGGCACTTGTCAATGCTATATGCTTTCATCCACA
GAACGAGATGCCAGGACCCTCTTTGTGAAGAATCTTCCCTACAAAGTTACTCAAGAAGAG
ATGAAAGAGGTGTTTGAGGATGCTGTTGATGTTAGATTAGTGACTGGCAAAGATGGAATG
AGTAAAGGGTAGGTCTTCAAATCTAAAAACGGGGGTGTTTGTGCTGAGGCTGTAAACGTT
GCCAATCCCTGTCAGTGTTGAAGGTGATGGCTGATTATCTGAAGTTTAGATGGAAACCAC
CAGAAAGCTTCCTGTGACAGTCAAGTAAACAGGCAGGTGCTGCACTTCCTTAGGCTAGAA
CATCAACACAGTGTGGGGAGGACTGCAGTTTTTTTGTCTTTCCCCTGTGATGCAGCACAA
GAAGAGTTGAGCTACATCTGGCTTCTGCCCCCCCTTAGCCTGGGGTCAGCCAGCTAGCTT
AATCCAGTGTGGCCTGGGAGCAGCCAGATAAGGGCTGGAATATTTGGTCCATCCTCTTGC
GTGCATTACTACCACATTCTTTTTTAAAAACCGCATTTGAAACACGGTTGGACACAGTTG
TGCCCCAAAGGACTTGATTTAATCCCCGTTTGTCACAGGGAAGTTGAGTGACTTGCCCAA
GATCACACAGCAGACAATATGTACCTCAGTGTTTAGTAGGTTGATGCTGTAGGGTGGTGC
TTCGCTCACGGAGGGACCTTCTTTTCAGGATTGCCTACATAGAATTTAAAACAGAGGCTG
ATGCGGATAAGGCCTTGGAAGAGAAGCAGGGAACTGAAATTGATGGACGTTCAATTATCC
TGGACTACACAGGGGAGAAAAGCCAGGGCCTAGAAAACTCCAGAGGTGGAAAGAACAATG
CCTGGAGCGGTAAGAGCTTCTTTGGGGTTTAAATGTTTGTGCTAGTTGCTTCCTTGTGTA
TGTATTGCTAAAATCAGCGTTCTGACTGCCTAGGAAACTGGGTTTGGCATCTGAATGCTA
GTGTCCGTGTGGATTGTCTGCACTTTTTTCTCTTTAGAGATCGAGCAATCTAGTCTCCAT
ATCCCTATTATGAGTTGTAAAACTTCTGCTACTTGTGTTCCTTAGTACCCAGCAAACTTT
CCCCCTAGACCCAGCCACCAAATCAACCCACTTACTATGTGCTGTGCACTCTTCTAAGCA
CTGGGATAGATACAAAGTAATCAAGTTGTCCCACATAGAGCTCACAGTCTTAGTCCCCAT
TTTCCAGATGAGGGAACTGAAGCACAAAAAGGTGAAGTGACTTGCCCAAGGTCCCACTGC
AGGCAAGTGGCAGAAGTGGGATTAGAACTCATGACCTGATTTACAGGCCCCTGTGCCATA
CTTTGTGCTGAGCACTGTACCATTCACTTGGGAGAGTATGGTAGAAGAGTTGGTAGACTG
TTCTGTTCTCTGTTGACTGTTCTCTGTTCTGAAACTTATTGACATGTACACCAGTAGTAT
GGGGGAAAGTGCTTTTTATAACAAAGCATTCCGAATTTCTAGGAGAGTCAAAGACCATTG
TCGTGAACAACCTTGCCTACAGTGCAACAGAAGAAGGTCTCCAGGAAGTTTTTGAAAAGG
CCACTTCAATCAAAGTGCCACAGAACCACCAGGGCAGGCCTAAAGGGTAAGAAGGAAATC
AATGAATCAATGCTTTCTGCTTGGTTTAAAAAAAAAGGATTCTGATTTTTGGTGGTTCTG
AACACAGACAAATGATTGAACTCCAGTTAGAACAGGGGAGGGCAAAAACACCTTGCTAAG
CTTGACTGAATGTCAAGGTTCAGTGGTGATCCCCATTGCTGAATCTGAGACATCCTTAGC
TGATTAGGAGCCATCACACTTAGAAATGCTGCTGCCTCCTAGCAATGATGGACCATTTAC
TCCTCAATTATCACTTACTGTGACTGTCCCTGTGAAATTGTGAAGAATCACCCACCTTTA
TCCACCACCTACTAGCATAGGCTGTACTGGAGTTGCAAATTTTGGTCTTGCACTACTGGG
CTTTATGGTTCATGTAGGGGGAGCTTATTGGGACTTAGTGATGCATACCGAATCTGAAGT
CCAGATGACACTCTCCATGGTGAGGGTAACTCTCCATGGTGGGGGTCTCTGATTTCTGAC
ACCAGAAAAGCCAGCGTGTTGTGGTTCCTGTAGCCTGGAAAGGTCTTGGCAAGGAGGTGC
TTTCAGAATGGATCTAAATGGTTAAATGGTCTCTTTCCAGATATGCATTTGTAGAGTTCT
CTACTCCTGAAGAAGCTAAAGAGGCTCTAAACTCCTTGAACAATGTAGAAATTGAAGGTA
GAACAATCAGACTGGAGATGCAAGGATCAAAAAATACTAACGCAAGAGGAGGGTTCAGCC
GTAAGTAGCCATTTTTTGTTCTAGGAGAGTTGGTTGGCTTAGACTTCCTTCCAAGAGCAA
GCTGGGTTCTAGCAATTAGTTGGCCAAAGAATGGCCTATGTCCATTAGTCTGCAGCTCTG
CAACTCCCATGCTGGATATGATGACTGATTATCTGAGACAAACTGATGAAACCAATAAAA
ATTCCTCTAGATAGTCAAGTTCTGATCCACATATTCAAAGCAGAAGTGGGCAGTCAAATC
ACCCTAATAAGCTCCTTTTGTGGGCAGGGAACACTTTGTTTTACCTGAACCCTGAGTCGC
TTTACTCTCATAAATCATGCAAGTCAAATCATTGCAAGTCTTGTGACTGCAGAGTGGCAA
CCAGGCCTCTTGTCCAAATTACAGTGAAATTGTATTGTCGAATATTTTTTGTGGGTTTTT
TAAATTTTCATGAACCAAGCTAAAATTTTTTTTTTTAATTTAGACCCATTCAAGACTTTG
TTTGTCAAAGGCCTGTCTGAAGAAACCACAGAAGAGACGTTGAAAGAGTCATTTGATGGC
TCTGTTCGTGCTAGGATAGTCACTGACCGTGAAACTGGGTCTTCCAAAGGGTAAGTCAGA
AAAACTGGTTGGGAAGTTTCGGAAACCATTTAAACTAATCTGCCTTGTTAAACTTGGAAA
ATGGTAGAGATCAAACCCTTTTCCTTCTCAATGAGCTCCTTCCTGCCAGACAGTGGCAGC
CTATGGATTCGCATGAGAAGAAAATGAACATCCCAGTTCCTGGCACTTTTACCTCTGTTT
CTAGATGGTTTGTTCTGCCAGGGCTGTGAGACATTCTTACCTTCATAAGGGTCAACTTGG
CTTTTTCAAAAACCATTAGGTCCTCCAAAAATTAAATCTGAGCTGGCTAGGGGTGGATAT
GATAGAGTGCAGGCAATCACTGAACTACTTGGACAGTCACACTGAAGATGTTGGATCTAC
CTGTGGGTTTGAGAGAATAATCTTCCAGCCACTTGCAGCAGCTTCATTCTGATAATAGTA
TGTCTAGGTCTGTCAGAATCAATATGGAGCAATCAAGTAGCAGGAAGATTGCACTGGACC
ACAGATAACAATTCTGAATGTCCAAGTGAATTGATGCAAGCGGGGTTTTGTGAGGGAAGA
GCAATTGCCACAAGAGTACATTTAAAATATTTGGCTGAACTGGAATGAGGACTACAGCTG
TGACCATTGTAATACCTGGAGATTAAAAAAAACCACCAAATACAGAATCTCTCCGCATTA
GAGTTTGAAATGACTGCTTCTTCTGTACTTTCAGATTTGGCTTTGTGGACTTCAACACCG
CAGAAGAAGCCAAAGCAGCCAAAGAGGCCATGGAAGATGGAGAGATTGATGGAAATAAAG
TTACGCTGGACTGGGCCAAGCCCAAGTCCGAAGGTGGTTTTGGAGGCCGCGGTGGTGGCA
GAGGAGGATTTGGTGGCAGAGGCGGTGGCCGGGGCGGTGGCCGAGGTGGGTTCGGTGGCC
GCGGCCGTGGAGGCTTTGGAGGTAAGGAGCTGTGCTCTGTTTCATTTGGCTGGTTGGGGA
ATGATGAGTGCCCCATTTAAGGCTGTAGGGATGGGGGATGGGCTAGGTTTTTTTTTATGG
TATTGAAGTGCTTACTATGGGGCAAGCACTCACACAGCGGGGTAGGGGACAAGATAATCA
GGTTGGACACAGTCCCTGTCCCACATGGGAGTCACATTAGTGATCCCCATTTTAGATAGC
CCTCTCGAGATAGCATTTTTCTTTTTACTTGCCTTTATACTATTTGTTGACACTGGCTTT
CCTACCACAAGGGGCTTTTGAGAACAATACTTTGTACAGTTCTAAGCATACATTTGCAGT
CAACTCACTAGATTATCTAGCTGGCCTCCCATATATTAGGCATTCACCGCGTCAGTCGTT
TTTCATTCCTTCCATCGTATGCAGAGCAAACAGCGCGGGGGCGAACAGAGTTACACCAAT
GTAACACCCCAATTTGACAGAGAAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1749, 2063..2215, 2850..2936, 3177..3318, 3466..3590, 3721..3847, 4408..4568, 5202..5325, 5920..6059, 6523..6649, 7354..7945
1347..1749, 2063..2215, 2850..2936, 3177..3318, 3466..3590, 3721..3847, 4408..4568, 5202..5325, 5920..6059, 6523..6649, 7354..7639
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved