Ornithorhynchus_anatinus Locus ENSOANG00000034191
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus ENSOANG00000034191
Ornithorhynchus_anatinus
ENSOANG00000034191
Contig3036
SNORA7
14979..15126
30340
TCCCAATCCTGGAAACCCACAGAATAGGACATTTTGCATCTGTTGGAAGAGGGATTATT
TTCCAGCAACAGGAGTCTTAATGTTCAGTTACCAGCTCTGTCTCCTCTCTGTGCCTCTGG
TCCCCATCTATAAAATGTCCATTCATCCTTTTGGATTGATAGATTTGGGTAATAGATTTT
AGCAGATCTTTTACACCTGGATAGTAAAAAAATCAAAGGGCTATTGCAGATTTCCACCAG
ATCGAACACAGGCATGGCCTGGCAGTCTGCCTGACCAAGTTCAGACATAATCAGTGGAAA
TGGATCCTAAAGCAGGCAGCCTCCATTTTAGAAGCAGACGGAGGCATAGAGTCTTTCTAA
ATTCAATTTCCAGGTCAGCAGTTCAAAGGTGCCTGGCACGAGCATTGTGATCTCAACCCA
TCTCAGGTCAAAAATGCTTCTGGAGTCAAAAGTTCCAGTGGTATTCACATCCAGCCAGGA
CCATTTTCCTTCTTGCGGGTGAGGTTTTTCTGGGTTCTGGAGGAAAGTCCAGAAGCCAGG
CTTTCGAGTCTAGATGTGGACTGTGTTGGTTGAGCACAGGGCCTCCAAAACCTCTTCAGG
AAATTTCCCCGGCTTCAAGCTCTGCTTCAAGCTCTGGGGAAGAATTCCTAAGTGTCAGAC
TGGCTGCCCACCTGGCTAACTTCCGGGGTCTCTTGGAATTTTTTAGCCATTTGGGAATGA
AAGGGGTCAGAGCATACCTTGGGTCTCAAGATGGGCTCAAGCCAGTTTCCCTCATCAAGA
TGGGGAGGCTGTGTGGTAATTTTTCCCTAAGGACAGTTTTTCAGGGAGACCCATTTTAGA
ACAGCCATATGCTGGCCTAATCCTGAAGCTCATTAGTGGATGCAGAGGGCGAAGCAAGCC
TGAAGAATTTTTAATTTGGAAAAGGAAGAGAGAAGTGGTCAATTTGTAATCCTCCACTCA
ATTGGTTTTGACCTTGTCTTCCTTTAATTTGCTTTTAATGCTTCTCAAGATTTACGGGCT
TACATATTTATATTTCCTGTAGCCTTCATCTCTCCAACAAAGTGTAAACGAGTTTTGTGG
GGCAAAAGTCCACTCCCATGCTGCCCTGCCTATCTACAGTCACCAGGTATGTACCGGGTC
TAACTCTTTCAGTGACAGCATCCATCAGTCCATCAGTCAGTCAACAGTATTCATCGAACG
CTTACCGTGTGCAGAGCACTGTACTATGTGCCTGGGACTGAGCTGGTAGACAAAACCCCT
GCCCTCAAAGAGACAGCTTCCGCCTGAAAGGAGCAGATGGGGATCTGCATTCATAACGTC
AAAAAGTTAAGTTCTGAAGATGGTTTTCTCTAAACTTCTAATACCTCACGTTACTACTAC
TAAGTACAATTATAATTATAGTAACCATGATATTTGTTAAGTGCATACTATGGGGTAGAT
AAAATACAATCAGGTCAGACATAGACCCTGCTCCACATGGGGCTCACAGTTTGAGGGAGA
GAGAACAAGTATTTGATCCCCATTTTACAGCTAAGGAAACCACGATCACATAGAAGGCAA
GTGGTGGGATGGAATTAAAACCCAAGTCTCTTGACTCCCAGTCACGTGCTTTTTTCATTA
GGCCGTGATTCTTCCTTTTGGACTTTCAGCCCTGGCAGCTGCTCATTGTCAGATTGCCCA
GACTGTTAAATAGTCTGGTTGTCACCTAATCTAAATGAGCTTGCTTTAATAATTTCTTGA
ATCTGTAGAGAACAGTTTTTCTTATCTTTTCAAATCAGTGATCTGATTTTATCTTCATAG
CATCCCTGTACAGGGAGGAAGGAAGGAAGGTATCGTTATCCCCATTTTATGAGGAAACTG
AGGAATAGAGCGGTTGTGACTTAATCATGGTCAAAATACAGGCTCATGGTAGCGTCGGAA
CTAGAACCCAGGTCTCCTGACTCCCAGCCCCTATGCTGCCACAGGCATCATCTCGCCTCT
GAATCTCTAGGCCAGCTTTGGAATTCCTCAGCTAATGGGAAGGATGGGACTTCTCGGTTG
AGCCAGCACACACATAAATTAGGACTTCCTTGGTCCATCCTACCCCTCCTGTTGCTTTGC
CCTGGATTTAATGTGCTTATCTTTTTAAGAGTGACTTTCTAATCTTGTAAAATGGCTAAG
AAACCTGTTTTTGAGGAGTTTTTTTCTTCTCTCTGGAAAGTTTCTTTTTTAAAAAAAAAA
ATGGTATTTAAGTGCTTACTCTTTGCCAAACACTGTTCTAAGTTCTGGGTTAGATACAGG
TGAATTAGGTTGGACACAGTCCCTGTCCCGCATGGGGCTCACAGTCTAAATAGGGGGGAG
AACAGGAGAACTGAAGCATAGAGAAGAAAAGTGACTTGCCCAAGGTCACACAGCAAGTAT
TTGTCAGAGCCAAGATAGAGCCCAGGTCCTCCGACTCCCAGGTCCGTGTTCTTTCCACTA
GGCCACGCTGCTTCTCTTCGTTACTATTTGGAGTTCAAAACTAGCCACCCTCTCACCCCC
AAATAGCAACCATCTGGCTTCTCTTTGGAGGCTCTGGCTGAGGCTCAGCTTGCAGGGAAT
AGGCACAAATTATTGACTTTCTGTAGAAATAATTGAAACTTCAATCCGGAATCACTCAAT
AACATTTACCGACTGCTTACTCTGTGTGGAGCACTGTACTAAACATTTGGGAGAGTACAA
TAGAGTTAGTAGCTACTATCCCTGCTCTCAAGGAACTTAGTGTCCAGTGGGAGAGAAAGA
TGAAGACTATGTGATTGTTATCTATAAAAAATCAAAAAAGGGAGAGTACAGAATGGCCTT
TCAAATCCCACTCCACTGAGCCCAGGAGGTTTAAAAGAAAGAAAGTGAAAAGGAAGTCAC
CTTTTCACCCAGTGGGAAGTAAGCATGTGGGATTTACCACCACAAGAAGTTGTATAAACC
AAAAATATCAGTAGGTTCAAAAATGGATTGGGATGAACTCATGAACAGTAGTTGACAAAT
GTGTTATAAGAGGAAAAAGCTCGAGATATTTGATGGTACCACCTTAAACTTTAGAGGACA
GCCCTAAAGGAGGACAAATATCACACTTGTCCTCCAAATCACCATTGGACGTCTTCTGTC
ACACTCAGTGTGGACCCTTTAATCATTCATTCATTCATTCAAACGTATTTATTGAGCATT
TACTTTGTGCAGAGCACTGTACTAAGCACTTGGGAGTGTACAATATAATACAAACAGACA
CATTCCTGCCCACAGCAGCTCACAGTCTTTATGCAGCTCACGGTGTACATTGTATAAGCC
TTCCCCACCATGTACCTCACCTGAGCTTCCAACTTATTGTCCTTAACAGAAGTTGTTTCA
TGTGAGACAGGCCACGCAGATTTGGATTTGGAAAGTATCTAATTGAATCCAAATTATTTC
TTTACTTCCGTGGAGTTACCTACCATCTTTGCAGCCCCAATCAATCAATGGTATTTATTG
AGTGTTTACAGTGGGCAGAGCACTGTACTGAGCACTTGGAAGAGCACAGTACCAGAGAGT
TGGTAGACACATTCCCTACCCCCAAGGAGCTAACAATCTAGAGGAAGAGACTGACATTAA
AATAAATTGCTATGCAATAGGGTTAGAAGTGGAATGAATATTATAATAGCTAAGGTGTAA
GGACCCAAATACATAAGCCATGCAGAAGGGAGAGCAGATAAGAGAAGAGAGGCCTTTCTT
AGGGAAAGTCTCTTGGAGTTGGTAAGATTTTAGCAGGGCTTTGAAGCTGGGAGAGAGGTA
GTCTCTTGGATATGAAGAGGGGGAGATTTCTAGAACAAAGGGTGAGATGGGCAAAGCAGT
GTGGCTTAGTGGAAAGAGCCCGGGCTTTGGAGTCCAAGGTCAGGGGTTCTAATCCCAGCT
CTGCTACTTATCAGCTGTGTGACTTTGGGCAAGTCACTTAACTTCTCTGTGCCTCAGTTA
CCTCATCTGTGAAATGGGGATTAGGACCGTGAGTCCCATGTGGGACAACCTGATTACCTT
GTATCTATCCCAGCGCTTAGAACAGTGCTGGGCACCTAGTAAGCGCTTAACAAATACCAT
CATCCTCAAAGAGTTGGCGGCGAGAAAGACAAGATCAAGGTTACAGTAAGTAGGTCAGTG
TTATAGGAGCAGAGTACGTGGGTTGGGTTTCGGTAGGAGATCAGCAAGATGAGGTAGACG
GGGGAGAGCCGATCGCATGCCTTAAAGCTGATGATATGGAGTTTCTGTTTTGATGCCGAG
ATAGAAGAGCAAGGAGACTTGAACTGAGAGGTTTTTTTTAGAGAAATGATCCAGCCAACA
GAGTGAAGTATGGACTGGAGAGGGGAGAGACAGGAGGAAGGGAGGTCAGCAAGGAGGCCG
ATGCAGTAGTCCGATATGAGTGAGCGGAAGTGGGCAAAGGGAAAGTCGTCAGGAACATTC
ATGTAGATATCGAGGTGTCCGAAGATCAGTATGGGGATGTAGAAAGAGGGAAGGAAAGTG
AGATAGGAAGTTTAATAAGCGGATGAACACTCGGGTTTCTACTGGGAGGGGCTTCTGCCA
CCCTCATCGATCACCTGGGCAGAAACTAATGACCAGAAACTACTGAATGACATTCTTTGC
ATTTCCTCAGTGACTGAATGCTGGTAGGTAGAGTAGCTGTTTTTTGCCTACTGAAATTTG
ACTTCTTTTGCATTTGAAAAAAATAAGGAATAATTAGGCTGACCATATTATTTTTGTTGA
ATTTGGGACGTCTGGATTCCATCCCAAATTCGTGTGCCTTTGCCTTCTCCCTCAGTGATT
AGAATTGCGTGAGTGGAGGGAGCATGGGGGGAAAGGAGAATAGGGTTAAAGTGCCAGGGC
ATTCTGGAGTATCCATAGCACAAGTCTCAGAGTGCTATGAAACCTAAAGTTAACCAGGTC
AATCAATCGGTAGTATTTATCAAGCTCCCACTGAGTATAAAGTCCTGTAATATGGCTTTG
GGAAAGTAATGCAGAAGCAAGACACACGCTTGCTGCTATTAGCTCTCTAGACTGAAAGCT
CAGTGGGGGCAGGGAATGTGTCGGTTTACTCTTATATGTACTATCCCGAGCTCTTAGTAC
AGTGCTGTGCACACAGCAAGTCCTCAATAAATCCAACCGAAAGGGAGTTACTAATCTAAT
CGATCAATCAATGGTATTTACTAAGTGCTTACTATGTGTAGAACACCATATGAAGCTCTT
GGGAGTGGTCAGTATGACAGAATTAGCCCATAATGAGTTTACAGACTCGAGGGGGAGACA
GACATTAATATAAATAAACAAGTAATTTATAATGTATAATTGATGGAGGAAGTGACAGAC
AGAAATCATTTTCCCTTAATGAGAACTGCAAGAAGACCAGAATATGAATGGAGTTATCCT
AATATGTGTAAACCAAACGTACTGATCATGCTTCAACCCAGAAGGGAAGTACGTGGCTTA
GTGGAAAGAGCACGGGCTTTGGAGTCAGAGGTCATGAGTTTGAATCCCGGCTCTGCCACT
TGTCAACTGTGTGACAGTGGGCAAGTCACTTCACTTCTCTGTGCCTCAGTTACCTCATCT
GTAAAATGAGGATTAAGACTGTGAGCCCCACGTGGGACATCCTGATTCCCCTGTGTCTAC
CCCAGCGCTTAGAACAGTGCTTGGCACATAGTAAGCGCTTAACAAATACCAACATTATTA
TTATTATTATTATTAAGTATGAGCTTTTTAAATGAGCAAGAGTTGCTAAGGATCAGAATA
AAATAGGGTGACCAGTTTTGCCAGAGCCCTCTTGATTCCAGGTTGTCTGTTTTCATACAT
TTCATCAATTTATAAAGTGGTATCTTAGACAGTACAGTGTTCTGCACACAGCAGGAGCTC
AACAAATACTATTGATTGATTTATAAAATTAATCAGGGACCACAGTGAAGTGTAGCAAGA
CCACACACTAATAATAATAATATAGTACTTATGGTATCTGTTGAGCGCTTACTATGTGCC
AAGCACAGTTCTAAACACTGGGGTGGATACAAGCAAATCCAGTTGGACACAGTCCCTGCC
CCGAATGGGGCTCACACACTTAATCTCTATTTTACAGGTGAGATAACAGAGGCACTGAGA
AGTGAAGTGACTTGCCCAGGGTCACACAGCAGACAAGTGGCAGAGCTGGGATTAGAACCC
AGGACCTTCGGTCTCCCAGGCCCAGGCTGTGTCCACTACGTCATGCTGCTTCTCACTAAT
TTTGGGGCCTAAAGGGGCAGACTTCTCTGATTTTGAGTTCCTTCTTTCTCTCTGATTTGT
CCATCGATCTTCAGAAATGCTGTGAATAACCCCTTAAGTATGTTATACAGTGTTATCAAA
ACTTACCTTTTCAAAATCCACAGTAGCAACAGATAAGGAGATTTTGTTGCAGTTGAATGT
GGTGTACGCTCCATTTAATTTTTGTTAGAGAGATTGGTTGGCTTGTGATTCAAAGGAGAC
ATGTGAAGGAGAACGATTTCAAACTAGGGCTTTTTCCCCTCTGACTTGAGTTTTAAATAA
AGTTAATTAGTGCCTCATTTTCTGTATCGGTTATATCTTCAGGGCACTAGAGGGGGAACA
ACAATAAAATGAGATTAACAGGCAGAGTCTTCAATGATACTTGAGAGCACTAGAGTATTA
AGTATCTGCAGACTAGGAAAATGTAACCAGATGCTACCGGTTACCTGTTAAACTGAGCTG
GCCTCGTTTGAAAGTATCTCCATTAATATGCCTATCTGGTTCTCAGTCACGGATCAAGTT
TTTGAAAAACTCAGACATTTGGACACTTGGACACCCTCGGACCTGGACACATGACACGAC
TTGTCATTTGGTCTGAGAGGAAAGATGAAAGAAGCTGCCGTTGCTTCGTCTTCTCCTGTC
AGATTGGCTTAATATTGCCATTCAGAAAAATCCACAAGCAAGAGACTCTAGGGAACCTTC
AAGCAGATACCAAGTGCTTAGTACAGTGCCCTGCACATAGTAAGTGCTCAGTAAATACGA
TTGAATGAAAGATACAGCATTTTCCAGGACTCCGAGGTCATGAGCACCAGTTAGTAGGAA
CTGAAGTATTCCCAATGTAATGACGGTTCATTTGGTGGGAGGGTGGAAGGAGGGGTTGTG
CCCAATCTCCACAGTGCTTAGTGCAGGGCACCACAGCCAGTCTGCTCTGAGCAAGTAGTC
ACTAGTGGTGATCAGCCCTCTCCCTGAGAGGACCTTGGTCACTGGCTCTAGCTGGTCTGG
CCCTTGGAGAGCATTCCCTGAGAAGATCGAGCCCTGAATGGATCAAGGAGCTGTCTTCCC
TCGCACTTCAGGGGGCTTGGAGTGAGGTGGTGGGGGAGGAAAGTCAGCCCTCCAACAAAA
TGGTGGTTAACTCTCCTTTCCCCAGACTCTTCTGAGGATGCTAACAGGCAGTGAGAAGCA
CTGAGAACAGCACAGCCAGAGAAGCAGCGTGGCTCAGTGGAAAGAGCCCGGGCTTTGGAG
TCAGAGGTCATGAGTTCGAATCCCAGCTCTGCCACTTGTCAGCTGTGTGACTGTGGGCAA
GTCACTTCACTTCTCTGTGCCTCAGTTCCCTCATCTGTAAAATGGGGATGAAGACTGTGA
GCCCCACGTGGGACAACCTGGTTCCCCTGTGTCTACCCCAGCGCTTAGAACAGTGCTCTG
CACAGAGTAAGCGCTTAACAAATACCAACATTATATTATTAGTGAGAAGACCTCACTTCC
ACTAGCCAGGAGCCACTCAGCAAATTCTCCTTTAGGCTTTTCAAGAAAATGGAGGCGATT
CTTGCATTTGTAGCAAGATTTGTTCGTTTCAGAGTGACCTCTGTTGGGGCCAATTTTATG
GCTTATTGCATGTTTTGTTTCTTTTTTTTATAATGGTATTTGTTAAGCACTTACTATGTG
TCAGGCACTGTGATAAGTACAAATTAATCAGATTGGACTTAGTCCCGGTCCCACCACATA
GGGTTCAAAGTCTTAATCCGCCTTTTACATTCGAGGCAACTGAAGCACGAAGTTGAGTGA
CTTGCCCAGGGTCACACAGCAGACTTGAGGTGGAGCCGGGATTAGACCCAGGTCCTTTTG
ACTCCCAGGCCCGTGCTCTTCTCAGATGAATTAACCACTTCGCTCCCGCTTCCTGAGATG
ACACCTGAGATGACATACATCCTTCCTACTTTGGGCCCAGTCTTCAGTAATAATTCTGAT
CAAGAACAGTTAAAGAAATGCAACCCCCATGCCAGGGAATGGCGAAGTTGCACCCCTGTC
TAGTATTCACCAACCGGGCCACCACTCAGATAATAATAATAATGGTATTTGTTAAGCATT
TACTATGTGCCAACAGCAGGGAGGAAATGAAACCTTATTTTTGCTAGTCCAGTCCAAGTG
GCTGTGTGCAAGGCCAGACAGGTCTACTCTCCATGGAGGTGTGTTGGGTTTTTTTTTTTT
TTTTTTTTTAAATGATACTTGTTAAGTGCTTACAGTATACCAGGTGTTGTACTCTTTAGT
GATGCTCCATCACTTGGTCTGATTTTCCGGCAGGGGGAATGGATACCAACATGGGTCAGA
GCCTACTGTAGGGAAGCAGTATGCTGTAGTGGATAGAGCATGGGCATGGGAGTTGGAAGG
TCATGGGTTCTAATCCCAGTTCCACCACTTGTTTGCTGTATGACCTTAGGCAAGTCACTC
CACTTCTGTGTGCCTCAGTTGCCTCCTCTGTAAAATGGGGAATAAGTCTGTGAGCACTAT
GCGGGACAGGGACTGTGTCCAACCCGATCTGCTTGTATCCTCCCCAGCGTTTACTACAGT
GCCTGGCACATAGTAAACACTTAACCAATGCCGTAATTATTTTATTAATTATTATTATGC
AATAAGTATGTTAGCCATCTAGGAATTGGGCTCCGGCCTCATACATGTTATAGTCTTCAA
TGTCCTGTGCTTGTCTTCACTCATGTTTGCATTATATGTGTTCCAGAGGATTCTCCAAAA
ATAATTATGCTGCCCGATTATTATTCATTTGAGTCCCGGAGATTGCTGGGGAGCACGGGA
GAGCATCCTATACATGAGAATCTGTCAGGAAAGTAATATGCCAGGGAGAGCTACCTTCTC
AAAAAGTAACTCATCCATCATTGCAATTGTGACACTGAGTTGTAGGGACTTCATCTCAGA
ATCGGTCCCTGTCTGCTTTAGAATAATAATAATAATAATTGTGGCATTTGTTAAGAGCTT
ACTGTGTGCCAGGCACTATCCTAAGCGCTGGGGTAGATACAAGTTTATTAGGTTGCACAC
AGTCTCTGTCCCACATGGAGATCACAGTCTCAATCCCCATATTACAGATGAGATAGGCCC
AGAGAAGTGAAGTGATTTGCCCAAGGCCACACAGCAGACAAGTGGCAGAGCTGGGATTAG
AATCCAGGTCCTTGTGACTCCCAGGCCTGTGCTCTATTCACTACTCCATGCTGCTTCTGA
GCTTCTCTTTGTCTCCTCTTTTGGCTCGCTGAAAAATGCCCTTGCTATATGATGCTGTCG
CTGTTATTTTTTCTTCATTATCAAGTGTACCAAAAATGTCTTGTTGAGACTTGGAATATA
TCCCCCATGAGAGGCTGTTTATCACACCTCTCTAAATAAACTTGTGGAAATTTTCATAAT
CGTTTTTATCTGTGAATGAAAACATGTTCAAATTTGTACAAAATATAAATTCCTGCAAAA
TATGAGCCAAATCTCCACTGAAGGTGCAATCCAAGGTGAAGTTTAGCTTACAGGTTCATC
TGCCAGGTCAGAGTCTGGGGTTTCCTTTACTGTGATGGCAGTTATACCAGTAATAGTTGC
TTCTCTTCTGGGAACCAAGGTGATTGCTTTTGAGCAAATAGATCTGAAGTAAGCAATTTC
ATTTAGAATTCTTTCCTTTGGCTTTTTGGTTAATCGATCAGCAGTAGTTATTAAGCATGT
GTGGTATACAAAACCCAATACTAAGCCCATGATACAATGTAACGGAAGTAAAACATACTT
TCCCTGTCCACACGGACTTTACAATCTAATGGATTTTTTTAATGGCATTTGTGAGTACTT
ACTATGGGCCAAGCACTGTACTAAGTGCTGGGGTAGACTTGGGATGAGGCCTAGAGAAGT
GAAGTGACTTATCCAAGATCACACCGCAGAGAAGTAGCGGAGCCAGAATTTGAACTCAGG
ACCTCTGACTCCCTGGCCTGTGCTCTGTCCACCAGCCATGCTGCTTCTCAATGTCAGTGG
CTTTGAATGGAAACTAATGAATGACGTACCCTCTCTGAATAATATTTAATTGATATTCAT
GAGGAAAAATAAAACAAGTCTCAGGGTATCTGGATTCCTCCACAGTGTTTATGTGTGAGT
GCTTGATGGAACCCATTAAATAGCAAGCTGTGGGACCAGAACCTTGGGCTGTCACAGCCA
AGAGGAAAGAACGCTTAGGATCTTTTGGAGAGCGAGAGTTGGCACTTGCTCTCCTGTTCA
TTCTGCTGCTTCTCCAAGGCCCAGTGATAATAATCACGATAATAATGGTAACTGTGGTAT
TCGATAAGGGCTTACTATGTGCCAACCATTACATTAAGCGCTGGGTTAGATACAAGATAA
TCAGGTCCTACAAGGGGCTCACAGCCTAATTAGGAAGGGGAACAGGTATTGAATCCCTAT
TTTGCAGATAAAGGAACTGGGGCATAGAGAAGTCAAGTGACCTGCCCAAGGTCACAGAGC
AAGCTCATGGCTGAGCTGGGATTGGAGCCCAGGGCCTCTGATTCCCCACCCCATGCTCTT
TCTATTAATAACGATGGTATTTGTTAAGCATTTACTATGTGCCAAGCACTGTTCTAAACG
CCAGGGTAGATACAGGATAATCAGGTTGTCCCACGTGGGGCTCACACTTTTAATCCCCAT
TTTACAGATGAGGTAACAGAGGCACAGAGAGGTTAAGTGACTTGCCCAAGGTCACCCGGC
AGACAAGTGGTGGATTAGAACCCATGTCCTCTGACTCCCAAACCCATACTCTTTCCACTG
AGCCAAAATGCTTAAGGGGACAGGTAGCAGCCTCGGGCCCGGCGCCCCCCCGGCCCATAG
GTGCAACACATTCTAGAAATGAACATCTATTTTTAAGCAGAAGCTTTGGGAGGACCAGAA
AATGGAAGCAAAAACGAAAGCAGCTCCATGAGTTGCCCACAGTATGCCAACACAACAAAG
GCTAACCTTCGTGAGCACATGTTGTCAGTTGGGCTGTAGGTGCCATTTGGGCCTTTTCAG
CTAACACTAGGCGTTGGTGGGTAAAGTTTACTGCTAGGGCATCGGCTTCAAATGAGGATA
ACGTGATATCGTTATTCAAGGGGGTTGCCGTCTTGTGATGCCCCCCGTTTTACGTCCCAA
TCAGGACAAAATGGATTCTTCACTACTTGGCATTCTCAGGATGGCCTTGGGCCCTTTGTG
GACAAGAGAAGCTTCACTTCTTTATCCTGTATTTCCCAAGCACATAGTACACTCACTGCA
TCAAGTGGACACTCCAAAAATGCTATGACTATTTTTTAGTGATATTTGCTAAGCACTTAT
TATGTATCAAACACTCTTCTGAGTGCTGGGGTGCGTATAAGCTAATCAGATTGGTGAATC
CTGCATGTCCTTGTCCCACATGGGGCTCACAGTCTAAGTAGGAGGGAGAATAGTAATTAA
TAATAATTATGGTCTTCGTTAAGCACTTAGTACGTGCTAAGCACTGTTCTAAGTACTGGG
GTATGTCAAGTTAGGTTGGGCACAGTCCCTGTCCATACAGGGCTCACATTCTTAATCCCC
ATTTTACAGATGAAGTAACTGAGGCCCAGAGAAGTGAAGTGACTTGCCCATGGTCACACA
GCAGACAAGTGACGGAGCCGGGATTAGAAACCACATCCTCTGACTCCAAGCTCGTGCTCT
TTCCACTAAGCCACGCTGCTTCTTGACCCTTCAGTCCCCACTCCAAAGGTGGGAAGACTT
AATGTTCTTGGAAATGAATACTCTGTTGAAAGTTACATTTTTGACAGGTGTGTAAGTCTT
TAGATGAAACACATACTCTCAACGCTGCACTGTAAGAGAGTGTGCCCAAGAGTCAGGAGA
ACCATATTTTTGCCCCAGCTTTGCCCTGGCTTCCAAGGTGACCTTGAGCAAGTTTCTTAA
ACTCTCCGTGCTTCAGTTTCCTCATATAATAATGTTGGTATTTAAGTGCTTACTATGTGC
AGAGCACTGTTCTAAGCGCTGGGGGAGATACAGGGTCATCAGGTTGTCCCACGTGAGGCT
CACAGTTAATCCCCATTTTACAGATGAGGTAACTGAGGCACAGTGTGAAATGGGGATGTG
GCATCTGCTCTTCTGACCCCCGTGAGACGGAAGCCATGTCTGATCTGAGTGTCTGTTTGC
CCCAGTGCTTAGCACAGTATTTGGCACATAGTATGCACTTAATACAAGAAACTTTAAAAA
ATGTGTTTTTTATGGTATTTGTTAAGCACTTACTAGTTGTCAAGCACTGTTGTAACTGCT
GGGGTAGATACAAGCTAATCAGGTTGGTCACAGTCACTGTTCCACATGGGGCTCACAGTC
TTAATCGCCATTGCATAGATGAGGTAACTGAAAGCGTGTCCAAAGTCATGCAGTAGACGA
GCGTCAGAGTGTTAGAACCCAGGTCCTTCTAACTCCCACGCCCGTGCTCTGTCCACTAGG
CCATGCCACTTCTGTGATGAAAGGGACAACAATATGGCCTAGAGGCAAAAATCAAGAGAT
CTAGGTTCTAATCTGTTCTGGTGTATGAGTTGAGCAAGGTGCTTAACCTCTCTGTGCTTG
TTTCCTCGCCTGAAAATCGGGCAGATAATATCTGGCCCACTCTAACTCTTAGGGTTAACA
TGAAGGTAAAATAAGATAATCAGATGTGAAAACACTTAGGAAAATAAGGCATCATATAAA
CTCAAGTATTAATATCACCTTTATTCTGGCTCCCGAGTTTGTTAAGCACAAGTCTTTAGG
GAGTAACAGCGAGCCACCACGTTACTCCTTAAAAAATATGAATGCAAAAAAAAAAAAAAT
CTTAGTTCATAGCAAAACCTATGCATGCATCTGGAAACTTTTCCTGGCAGACAGGATTCT
GCAGGATGCTGATTCTTTAAAAATCAGGCCTTCTATAATTGGAATGTATTCTTCTATTTT
TAGATGGGCATTTCTGTGTGCTTGTTGATTTCCCTTGCAATGAGATCAGTAGCCAAGAGC
CATGAATCATCTAGGGTAATGTGTGGTTATCTTTGAATAATCACCCTCTTTCGAGCAGCC
TGGTTGTCATTACTGATTCAAAAAACTCTCTATGCAGGACTTATAACGTGTGTGTGTGTG
TGTGTGTGTGAAGAGTACTTGGGTTCTTTCAATATCACAATAGTTTCAACTGGGTATATT
TTTGTCCCCCATTATGTTTCACGTGGACACTGGCTCTTGTTCTTCCCACTCATTGGAGTT
CACCACATCCAGCAACTCTGAAAGGAATTGAAGCAGCGTGGTGTATTGGAAAGAGCACAG
GCTTGGGAGTCAGAGTTGTAGGTTCTAATCCTGGCTCCACTGCTTGTCAGCTGTGTGACC
TTGGGCAATCCACTTCAGTTCTCTGTGCCTCAGTTATCTCATCTGTAAAATAGGGATTAA
GACTGTGAGCCCCACCTGGGACAACTTGATAACTTGTATCGCCTCCAATGCTTAGAACAG
TGCCTGGCACATAGTAAGCGCTTAACAAATACCATCAGTATTATTATAATTATAATATGG
TATAATTATAATGATATTTTTAAAGTGCTTACTCTGTGACAGGCACTTTTCTAAGCGCCG
AGGTAAATACAAAATAATCGGATTGCACGCAGTTTCCGTTCCACATAGGGCTCACAGTCT
TAATCCCCATTTTATAGATGAGGGAACTGAGGCATAGAGAAGTGAAGTCACTTGCCCATG
ATCACACAGGAGACAAGTGGAGGAGACGGGATTAGAATCCATGACCTTCTGACTCCCAGG
CCCGTGCTCTATCCACTAGGCAACTCTCATTTTCAATTGCAGTCCTAATTTTCTTTTAGG
TGCCTTATTCTAGGTTCAAGTGACCTTTCACATTCCTTTGAATTGGATATTGATATACTC
TTCAGGCGGGTTGGCATTTTTCCCCACTCTTACTGTCTAATATTCTCCTTTCTCATCAAG
AGCCCTTCTGCAGGATCTGTCCATTTGGGCTTTAGGCAGATCTTTGGTGTGGGAGGGGGC
AGAGATTCATTCATTCATTAGTATTTAATGAGCGCTTACTATGTGCAGAGCACTGTCCTA
AGCGCTTGGAATGTACAATTCAGCAACAGATATAGACGATTCTTGCCCAATAACAGGCTC
ACAGTTTAAATGGGGGACACAGACAGCAAAGCAAAACAGAACAAAACAAAACAACATCAT
CAAGATAAATAGAATCATAAGGATGATAGGGTGGTGAAGCACCGAGGCTTTACGTTGTTA
GGAGTCAGTGGAGCATATGAATGGTATATGCGTGGTCCACATTTAGGTAGCTCTTTGCCC
TGTTTGTTCCGACAGGATAAGCGTTGACCATTAATGACCCGCCTGGTCACTTGGATGCTG
CTTGTCATGTGGGCCGAAGTGAAAAGGGGCAAAGGAAAAATTGGTTAGTGAAATGGTTGT
CCTTAGCCAGCACTGAGATAAGAAGAGGGAGAGAATTTGGATCAGAGGAGAAGAGGGCAT
GGAGGAAGCGGGGGTTCAGTCCCTTGGCTGAACGTGTTTTTTCTCTCTCTCCAGTGGTCT
TTGTCTGATTATTTATTATTTGACTGGGCTTCCACTGGATTTGGCATTGCTGTGGAGCCA
GTGGAAGGAGCATGGGCCTGGGATTCTGAGGACCCAGGTTCAAATCCAGCTTTGCCATTG
CTCTGTCTGGAAAACCTTTGAAGGCAGTAGGATTTAATTGACCCCCTCAGGGGTCAATTA
CACCTGGACCTGGAGTTTCCAGTACTCTACCAGTCTTGACTACGGGAGGGAGAGTCAGGC
AGAGGCATAACCATTCCATTCTTGGCTTGGCCAGTGGCTACTGAGTAGAAGGCTATCTGC
TACAAGCCAAGACTCCCCTGTTCTGGGCAATAGCAGCACGGGAGAGAGTCAAGGGTGGAG
ATTTGGGTTTACTGCGTTGAGGGAGGCAATGGTAAACCACTTGCATATTTTTACCAAGGA
AACTCTATGGATACACTACCAAAACGATGGCAGATGGAGGTGGAACATTCTGGGAGAGAT
GTGTCGATGGTGTCGATATGGGTCGGAGATGACTCAACGGCACAGGATAAGACAAGGATT
TAATTCCCATTTTACAGGTGAGGAAACTGAGGCACCGAGAAGTTAAGTGACTTGGCTATG
GTCACATAGCAGACAAGTGGCGGAGCTTTCTAAACAGAGCTGTCTGGGAGGATCGGGTAG
TATTCCTCACACAATCTCCAGTGAGGAGGGATTTTTTTTTTTCCATTTGTTGAGTTGAAA
GAGAAATGGCTCTCTGTAATAACATAATCGATGTTTTTGAGCTGCTTTCATTCCAACAGC
TCTGGGGGCAGTTTTGACCTCCATTTTTGGAGAGGGGAAACCCGGAGACTCTTTACCTAA
AATCACCAATCTAAGGCTAAGCCAACCTATAACTTGGAAGACTTGACTGCTAGGTAGGGG
GGCCAATGGTAGCATTAAAGAATTCTTGGCACCTCTTTGCCAAGGAAACTAAGTGCATTA
CAAGGACAAGTAAATGTTCTTTGGAGAAAATGATAGAACCTATCTAGGTGATGAGCTCAT
TCCTGGGGAAACCCTCCCTCCCACTCTCGTTACACTAGAGTCATTGTGTTCCACTCCCAG
ATCCCTCTAAATATGGAAACAACTTCTAAGCTGGGACTCCCAGCAGGAGCCTTGGCAAAA
TGGGGCTGGGAGAATTTTAAAGAATTTTAAAACTAAAATCCTGGACAAAAGGGCATCCTG
AACCTTATCTATACAACAGACAGACCAGCTGAAATCTACATGAATGGCCCAGGGTTGGGA
TTGCCTGAAGGTCTGGAACTGAATTTGGAAGAGCCTTTCATCCATGGGCTCATGGGTTTG
CTCTTTTCAGTTAATCTTTCCAGTCATGGAAGAGTTCGACTCAAATGGGGCCGACTTCAT
GACTGTTGCTGCTAAAGTTTGTAGCTTCTCTCTCTCTCTTTCTCTCCAGATTTATTTTGC
ATGCCACAGCTTATTTAGCTTTGTTAGCCAAATTCAGTCTGCTGTTCAAACTTCAGAAAA
AGATAATTTCTGGCCATGTGGTCATTGAACTTTCGGATGATTTAGCAATTCCAAAAAGGA
CTAATGGTGTTCAGTCCTGAGTGCCCTAAGACTCCTTGAAACCAGACAGATATTTTATCT
GCCTCTATTTGAGGTCATGCAATGGATCTCTCTTTGGACAGGCAGACTATTAAAGATTGA
TTCCACTTTCTGTTGAATATTCATGACTATTAAAACACGATAAAATCCGATTAATTTCCC
ATGCCACCTATGATCATTTCTCCATTAAAACCAAGTGCAGTCGCCTGAAGTTTCTTCTAG
TAGAATGAGAACATTTGCCTGAAAGACTTTCACAATTTATGAACCCATTTGTAATCCAGG
GTCATTTCTGGGATGTACAGAGGTATTTTTCCTAGCTGCTTCCTCAGATGGAAGATAAAT
GGCCCCAAATCCTCTGTTGGGATCTTCTCTGAAAGAAGGTGACTCAACTAGGAGAAGCAG
ATTGGCTTAGTAGATAGAGCAAGGGCTATCCTTCTGACCTGGGTTCTAATCCCAGCTCCA
CCACTTGTCTGATGGATGACCTTAGACAAGCCATGTCACTTCTCTGCCTCAGTTACCACA
TCTGTAAATTGGGGATTAAGACTGTGAGCTCTATGTGGGACATGGACTGCATCCAACCTG
ATTAACGTGTATTTACTCCAGCGCTTCATACAATGCCTGGCACTTAGTAAATGCTTAACA
AACACCATAAAAGACCCCTATGCCAGAACTCATGTTTTCCCTCTGTGCTGCGGCTAGAAC
ACACCAGTAGAACTAGGGGAAATTCTTCTGACAGTATGGTTCTGTTTAGATATGGTGTGG
CACAGTGTATGAAGAAACCTAGGCATGAGGAGTCAGGCATATGTCAATACTACATCATGA
GTGTTTCTTAAAGTCAGGTTCTTTCACCAACACAACCCCCAACATTATAGGAGAACTGAT
TCCATCAATCTTCAGGTCCTTGAAAAACCAATTTTAATGATTCTTTGTTCAGCTTCATCA
GTATTTGCAAGTTATGTTGCCCTTTGACTTCAGTGCTTATGACACCCCTGAGCTTAGGAC
ATTTCTTCGGGGAGACCTGTGGCTCCCCTCTCCCCCTTTCTCTAGGGCCCTTGCATCCCC
CTCCTAGGAGTCTGTCCACACAGACACCACTTTCAACTCTCAAACAGTCAAGCACTTACT
CTGTAATATGCCCTGATGAGAGTACAGTTAGAAGGCCTGGGTCCTCATCTCGGCTCTGCC
ACCTATCTGTTGCATGATCTTGGGCAAGTCGCTTCATTTCTCTGTGCCTCAGTTACCTCA
TCTGTAAAATGAGGAAACTGAGCCCCATGTGGGACATGGTTGTGTCCAACCTTATTATCT
TGAATCTACCCCAGCACTTAGTATGTTGCCTGGCACATATTAAGCACTTAAGAAGTACCA
TTTAAGAAAAAAAAAAGATGGGGAAAGTAGTGGCCTGCCAGGTGTGAAGGGGCTTGAAGT
TCCAGGTAGAAGGGAGGATATGAGCAAGAGGTCAATGGTGAGAGAGGTGAGAACGAGGCA
CAGTGAATAAATTGGCTTGAGAGGAGTGAAGCATGTAAACTGAGGTATAAAGGAAGAGGG
AGCAAGGCTAACTAAAGAGAGAGACCCTGATTGAGTGTCTTAAAGCCACTGGTCAAGAGT
TTCTGCTTGATGCAGAGAGGAATGGACAACCATTGGAGATTTTTGAGGAATGGCTAGGTG
TGCACAGACAATATTTTAGAAAAGTGGTCCAAGCAGCAGAGTGAACCATGTCCTGGAGAG
GGGAGAGACTGGAGGTAGGGAGGCCCACAGGTGCTCTCAAATTTTTAATCAGTCAACCAA
ATGGATAGAGCACAGGCTGGGAGCCAGAGAACCTGGTTTCTAATCCTGTTCTGTGACCCT
GGGCAAGTCACTTAACTTTTCTGGGTCTCAGTTTCCTCATCTGTAAAATGGGGATTCCAT
ACCTGTTCTCCCTCCTATTTAGACTCTGAGCCCCATGTGGCTCAGGGACTTTGTAGAATT
GGTAGGTGCTCTCCCTACCCATAGGAAATTGCTAACCTTCTCATTCTATCTCACCGTGAC
CTCTAGCCCACTTCCTGCCTCTGGCCTGGAACACCCTCCCTCCTCAAATCTGACAATTAC
GCTCCCTCCTTTCAAAACCTTATTGAAGGCGCATCTCCTCTAAGAGGCCTTCCCTGACTA
AGACCTCCTTTCCTCTTCTCCCACTTCTTTCTGTGTCTCCCTGACTTGGTCCCTTTTATT
CATCCCCCCTCCCAGCTCCACAGTACTTAATAATAATATTATGGCATTTTCAAGTGTTTA
CTATGTGCCAGGCACTGTTCTAAGCAATGGGGTAAATACAAGATAATTGGGCTGGACACA
GTCCCTGTCTCATAAGGGACTCGCAGTCTCATTATTTATAATGTCTGTCTCCCCTTCTAG
ACTGTAAGCTCATTGTAGGCAGGAAATGTGTCTGGTTATTGTTGTATTGTACTCTTTCTG
GTGCTTAGTTTAGTGTTCTGCACACAGCAGCGTCGCTGAGTTGATAGAACACAGGACTGG
GAGTCAGAAGGGACTGGGAGTCAGAAGGAACTGGTTTGCTATCCTGGCTTCACCACATGT
TGCTTTGTGACCTTGAGCAAGTCACTTAACTTCTCTGGGCCTCAGTTACCTCACCTGTAA
AATAGGGATTAAAAATGTGAGACAGGGACTGTGTCCAGCCTCCTTAGTGCTTAGAACAGT
GCTTGGCACATAGTGAGCACTTAATACCCTTAATACCATGAATATGATTGAAGGAAGGAA
GGAAATGAATAATAATTGTGGTATTTGTTAAGTGTTTACTGTGTGCCAAGCACTGACCTA
AGCACCGGAGTGGATACAAGCAAATTGGGTTGGACACAGACCTGTCCCACCTGGGGTTTA
CAGTCTCAATCCCCATTTTACAGACGAGGTAACTGAGGTACAGAGAAGTGAAGTGAGTAC
AGAGAAGTGAAGTGACTTGTCCAAGGCCACACAGCAGACATGTGGTGGAGCCAGATTTAG
AACCCTCGAGTTTCTGACTCTCAGGCCTATGTTCTATCCACTCTGCCATGCTGCTTCTCT
AGTATAAGCACTGCTGCGCCCCATCCCACCCTGTGCTGTCCCTCCACCCTTCCCCTTCAC
CCTACTGCCCCCTCCCTGAGGGGCACTTGGAGCCAAGCGCCTCACCCACTCACTGTCCAA
AACTAGGCCCGAGCCCAGCTCTGGGCTTGCATGAATTATGCTTATTGCATTAATCCTCAT
TTAGTAGAACAGTTGTCCCTGCCCCACCACCAGTAGGGGGCACTAACACTCTCTGGAAAC
TGTTTAAAACATTGAAGAATCATTTAAAATACATATTTCTCCGATTATGTAGGGGTTGTT
CCCTGAAAATCCCTATATTAAAGAAAATTTGAGTTGTGGTTCCCTGGGCTTTATTGCTAT
TGTTCTCGTCTGTCCGTCTCCCCCGATTAGACCATAAGCCCATCCAAGGGCAGGGACCCT
CTCTATCTGTTACCGATTTGTACATTCCAAGCGCTCAGTACAGTGCTCGGCACATAGTAA
GCTCTCAAAAAATACTATTGAATGAATGGCTTGACTTGCACACAACCGTTTCTTCCTACA
ATGCGTTGTAATTCTAACCAGGTAATAATAATGTTGGTATTTAAGTGCTTACTCAGTGCA
GAGCACTGTTCTAAGCGCTGGGGTAGATACAAGATAATCAGGTTGTCCCACATGAGACTC
ATAGTCTTAATCCCCATTTTACAGATGAGGTAACTGAGGCACAGAGAAGTTAAGTGACTT
GCCCACAGTCACACAGCTGACAACTGGCAGAGCTGGGATTCGAACCCATGACCTCTGACT
CCCAAGCCTGTGCTCTTTCCACTGAGCCACACTGCTTCTCTAGGTAGAAGTGTGCTTTTG
GAAAAGTGTTCCCTAATTTCCCCAGCAGCATCCTGTCCAAAACACTTGGTGAAGCCAGGT
GTTATGGGAGAACTCACTGTATCCAGAAAGCAGGAAGAACATCTGACCTGCCTGCCAGGT
TGCTAAGGTAAAAGCCAGTACATTTGAGCTTTTAGAGCCATGGGAAGAGGGTGTGCCCGA
GAGAAAGGAAGGGATTTTGATGGCAGAGGTGGTTGGAGAGCACTGTATTCTGAGTGTCTC
AGTTCCCTATGTCAATCAATCAATAAGTCAATGGTATTTATTGAGCGCTTCCTGTATGCA
GAACACTGTACTAAGGGCCTGAGATGGTACAACCTCTCCTCCAAGAGGCCTTCCCTGACT
AAGCCCTCCTCTTCTCCCACTCCTTTCTGCGCTACCCTGACTTGGTCCCTTTATTCATCC
CCGCTCCCAACCCTACATCACGTATGTACATATCTGTAATTTATCTATATTAATATGTGT
CTCCACTTTTGTGTCTCTTCTGTTTATCTGTTTTGATGGTTTTGATACCTGCCTACTTGC
TTTCTTTTGCTATCTCCCCCTTTTAGACTGTGCGCCCATTGTTGGGCAGGGATTGTCTCT
ATCTGTTGCCGAATTGTACAGTCCAAGTGCTTAGTACAGTGCTCTGCATACAGTAAGCGC
TCAAAAAATATAACTGAATGAATAAAATACAACAGCAGGCACATTCTATGCCTACAATGA
GCTTACAACCTAGATGGAGACAGATGTTAATATAAATAAATTACAGATATGTACATAAGT
GCTGTGGAACTGGGAGGAGGGAAGAACAAAGGGAGCAAGCCAGGGCGACACAGAAGGGAG
TGGGAGAAGAAGAAGGGGGAGCTTAGTCAGGGAAGACCTCTTGGAAGAGATGGGCCTTCA
TAAGATTTTGAAGGAGGGGAGAGTAATTGTCGGATTTGAGGAGGAAGGTCATCCCAGGCC
AGAGGCAGGAGGTGAGCAAGGGATTTGCGGTGAGACAGACGAGATCGAGGCATAGTGACA
ATGTTAGGTGTAAGGTGTGCAGGCTGGGTTGTAGTAGGAGAGCAGTGAGGTGGGATAAGA
GGGAGCAAGGTAAATGAGTGCTTTAAAGCCAATGATGAGGAGCTTTTGTTTGATGCGAAG
GTGGATGAGCAACCACTGGATTTTTTTGAGGAGTGGGGAAACATTTCCTGAATGTTTTTG
TAGAAAAAATGATCCTGGCAGCACAGCCCTCTCCTGTCTGTGACTCCTCTAGACTTCGAT
CTGGACCCTTTAATCCCTTGATAATCAGCCCACCCTCAGCCCCACAGTACCGATCTACAT
ATCTGTAAGTTATTTTAATGTCTGTCTCCCTCTTCAGACTGTAAGCTTGTTATGGACAGG
GAATATGTCTACCAACTCTGATATATGGTATTCTCCAAAGCACTTACTACAGGATTCCGT
GCATGGTAAACGGCTCAATAAATATCATTGTTGTTTTTTAAAGGATTCTCCCGATGCAAA
AGAAATGTTAAAAAAAATCACACTTAAATTGACTGTGTGTTCTGGAGTTGGTTAGGGTGG
CTGTGTTGATCAAACAAAAGCAATTCCGTTACATTCGGAAACTGCTTCTGTAATGAGAGC
AAGCCAGACGGTAACTCTTTCAGGTGAAATCAAAAACAAGACACCAAGGGACAGTCATTT
TGTCAAAAATGTCTTGAAAACTCCCTTGTGTATTTAAAAGGAATCTGCTCATTTATTTAG
TTGCAAATTTTCATGCTTAAATGAAACACTAAAGGGAGACTCCAAACACTTCCGTTGATG
TTATGGTTAATGGAATCTTCATGTGACTTCACAAATTGCCACTCAGCATAGATTCTGAAA
AATAATAAGATCAAAAGTTTGTGGGAGACATTTCAATTTAATGCTCAATTCTACCCAAAA
TCAAAATCCGTGCCCATTTAAATATTTCTTTGGCGCTTACAGTACCGCTAAGTGGTTGGG
CCATTGAACAGATCCTGTTTTTGCCTTCTGAGAGAATTAAAACGGTCATTAGAGAGAGAC
TAATCCTATTGCTGTTTTATATTCCATAACTTGATTTGCTCGCTTGCCCTTATTAACTTA
CAGAAACTAAAAGTAGATTTTGGTTTTCAGAGAAATAACCAGCTTATCAGACATCTCAAA
GAAGGCATTTCCCTTTAATACTCTTTTGGGAATTTTGCAAGGTGATTGAAACAATTTTGG
CATGAAATGGCTTAATTTATTTTATTTTTCCATGAAAGCAAAATCAGATCAATTCCAGGC
TGGGTTATGTTGCCCAGGGGGCTTCTGGAAATAGGCAATTTCTAATAGTTGGAAGAATCA
AGTGTAGTTCTTTGCAGATTTAAGCCCTTTCTTAATCCTCCTCCTGGTGGCCAACCTTTA
TTCAGGATCTTCTGGGAGTCCGAATGCCCTCATAAAAGTGTCATTTTGTGATGAGCACCT
TCCCCCAGTATTAAACGTCCCCAGTGCCTTCAGGGGCCCGCTGCTACCCAGACCTTCTTC
AGCCTGTCGTCTACTACTGGCAAGTCTTCAAACCCCGGGCAGCTCGGGGGAGCTCTGACA
CGGTGAGCGCTCAATAAATACCACTGATGATGGAGGATATAATAATAATGTTGGTATTTG
TTAAGCGCTTACTATGTGCAGAGCACTGTTCTAAGCGCTGGGGTAGACACAGGGGAATCA
GGTTGTCCCACATGGGGCTCACAGTCTTAATCCCCATTTTACAGATAAGGTAACTGAGGC
ACCGAGAAGTTAAGTGACTTGCCCAAAGTCACACAGCTGACAAGTGGCCGAGCCGGGATT
CGAACCCATGAACTCTGACTCCAAAGCCCGTGCTCTTTCCACTGAGCCACGCTGCTTCTA
CGATATCTAACCCAGAGGGCCTAGGTTAGGCCAGAGCTGCATCTGGAACCGGGGAAGCTA
ACATCCCACCCCTAGGCCCGGCCCGGCCCCAGCCCTGACCCAGGAGGGCAAGCCTGTAGT
CACATTTCCTCCCAGACTAAGCCCCCTCTTTCTTCTTCTCCCACTGCCTTCTGCATCACC
CTGACTTGCTCTCTTTGTTCTTCCCCCTCTTCCCAGCCCCAACTATGTACAGCACTTATG
TACATTTCTGTCATTTATTTATAACAATGTCTGTCTCCCCCATCTAGACTCGTTTTGGGC
AGGGAATATGTCTGTTCTTTGTTATATTGTACTCTCTCAAGTCCTTAGTACAGTGCTCTG
CACACAGTAAGCACTCAATAAATACGATTGAACGAATGAATAAATAGGCAGCCTGGGACC
CAGCCTCAGTCCCCAGACCGGGGAGGAGCAACCCAGCCTAGTGGAAAGAGCACAGGCCTG
AGAGCCAGAAGGAGCTGGGTTCTAGTGCGCTGTGACCTTAGGCAAATCATGTCACTTCTC
TGGAACCTCAGTTACCTCATCTGGAAAATGGGAATTAAGACTGTGAGCCCCAGTGGGACA
TGGACTGGCTCTGACCTGATTGCCTTGTACCTACCCCAGCGCTTAGAACAGTGCCTGGAA
CATAGTAAGCACTCAAAAAATACCATTAAAAACAAAAAAGTTAGGGTGGGCCCATGGACC
ACTAGGGAAAGATCGTGGACTTCCAGGCAGGCATAATGCCTTTAGAGAAGCACTAAGGTC
TAGCACGGGCCTGGGAATCAGAGGGACCTGGGTTCTACTGCCTGCTCTGCCAATTGTCTG
CTGCTGTGTGACCTTAGGCAAGTCACTTCACTTCTCTGGGCCTCAGTTCCCTCTTCTGGA
TAATGGAGATTAAGATTATGACCCTCTTCTGGGTTAGGGACTGTGTCCAACCTACTTTGC
TTGTATGAACCCCAGTGCTTAGTACAGTGCCTGGTATATAGTAAGTGCTTAACAAATACC
ACAATAGTCATTATTATTTGCTAGTTGGACACAGTTGGTGCTGTTGGGTCTTGTACAAAA
CAAATGGAACTGTTTATTCATTTGATATAGTATTCGGTAAGCCACTACTGAGTGCTGACC
ACTAAACCACGCGCTGGGAAAGTACAAAATCGAAACCGAGACACCGCCCATGCCCTGTGG
AGTATTTACCAGCTGAGAAGCCATCGGTCTAGGGGAAAGAACTTTCAGAGGCTGCTTTAT
CTCTACTGTATTTTACTATATCTTTGTGGCTTTGAAATAGTTATTTTTCTACAACATTTG
GTCCAAGTTTAATAAAGGAAACAAATACCTCATTTTAAGCAGTGGACCAAAATAAGAGCT
AGAGGGAAAGGAGATTAGAGTTCAGGGGAACAGTGAGACACTGGGAGGCAGAATATGATC
ATGTCCCTGTACTTTGTACGGAGAAGGAATCCGGCTGTCACCATGAAAAGGTGACCTCTC
TCCAGAGCTGGGCTGACTTTCAAAAAATCCCTGACATTCAGGATTTATGGATTCGAATCC
AGCACAAAGCCTGTTAAAATCATCACTGGTATTTATTGAGCACTTACTGCGTGCAGAGTA
CCGTAATAAGTGCTTGGGAGAGTTGGGAGACACATCCCCTGCACACAGCAAGCTTACAGT
CTTGTAAGCTTAACCTAGTGGGGGAAGACAGATATTAATATCAAATAATTTATAATCCAG
ACCGATTGCTTAACCAAACCTGGGGGGAAACTCAGATAAGCTCATTTCTGGACTATAAGC
TTGTGTGGGTAGGGAATATGTCTGCTTATTGTTATATTGTATTCTCCCAAGCACTCTGCA
CATAGTAAGTGCTCAATAAATATGATTGAATTGAATGAATGAATAACATAAATGATGCTT
AAATAACTAAGCAAAATTGAGTGAATGCCAGTGTCATTTTGTTTGGGTCTTTGAAGTTTC
ATTGATCTGAATTTGCCTTAGTACTGATGACTTTGAATGATTAGCTTTCTTCTGAAGTTT
TTTGTTTCTGTTTGAAAAATCCCTTCCTTTTACTATCAATCAGTAGTATTTATTGGGCAT
TTGTTATGATTCTGGCATTTATTAAGTACTTAGAGTGTGCTAAGGTACAAGGTTATCGAA
TTGAACCCAGTCCTTGTCCTACATGGGGTTCACAATCTATCTCATCCCAGTTTTTCACAT
GAGGAAGCAGGCCCAGAGGGGTTAAGTGACTTATCGAAGGTCACATAGCTCTCCAAGGGC
AAACCTGGGACTGGACTCTGGAAGTCTCCAGATTCCCAGGGCCATGCTCTTTCATGCTAA
GGGCATAGTACTAAATGCTTAGGAAAGTAAAATTGAAGTAAAGACCTTCCAGGAGCTCAT
GGAGACAGGCAGGTACAACCTGTTTACAAACAGTGACAGCAGAAGGAAGAACTTAGCTGC
AAACGGTAATAGAAAGAATTTGGAGAAATCAATTAACGAGCGTGGTCCAAAAATCGATAG
ATACCCAGTTCTCTTAAAATGCAGGAGTTGGTTGCATTCTCACAAAACCCCAAGCTGAGG
AAAGCTTACGGTGTCTGATGTCATGCACAGGCTGTTTCTTCCAACATTACGGCGTTCCAT
GTCCAACCTGCTCGTGCTGTGGGATAAATGTTCCCTACAACCCTACCGTCACTAGCCACA
GTCCTTGGTGCAAATGTAGGTTCTTGACAGAACTTGTTGTGCATGTCATTGATAAGGTGT
CTGTGTATGCTTAAGTGCTAGCGGTACCTATTGGAAACAATTGGTTAATCATTGGCAATT
ACTGAGCACTTACCATGTGCAGTACACTGTACTAAGGGCTTGGGAGAGTACAATCCTACA
GAGTCGGTAGACATATTCCTGCCCTCAGCGAGCTTACTGTCTAGCGAGGGTGGGTGGGAA
GGGAATTAATCAGAAAATGCCTCCTGTAGGTAGTGAGATATCAGCAGGGCTTTGAAGATG
TATTGGTGTATTGTACTTTCCCAAGCGCTTAGTACAGTGTTCTGCACATAGTAAGTGCTC
AATAAATATGATTGAATGAATGAATGAATGAATGAATGAATGAATGAATGCATGAAGTGG
GCCCAGACATGTAGCACGCCTAGAGAAGAACTAGACTATTCTTCATATCCTAAAACAGAA
AGGCATTTCTCAAAATCCTCTTAGCCATTCTGCTTTTGGGAAGGACTACTCCTAAACTAT
CTTAGACAGATGAGGGTTTATTCTACCTGTAATTTAATAATAATAATAATAGTGGTATTT
GTTAAGTGCTTACTATGTGCCAAGGACTGTTCTAAGCAATGGGGTAGATACAAGGTAATC
AAGTAATCCCATATGCGGCTCACGGTCTTAATCCCCATTTTACAGATGAGGTAACTGAGG
CACAGAGAAGTGAACTCACTTGCCCAAAGTCACACAGGTGGTAAGTGGAAGAGCTGGGAT
TAGAACCCATGACCTCGGTCTCCCAAGCTCGTGCTATTTCCACTCAGCCATGCTGCTTCT
CCAATTATGGTATTTGTTAAGCGCTTACTATATGCCAGGCACTGTTCTAAGCGCTGGAGT
AGATACAAGATAATCATTTTTGTATTTGTTAAACGCTTACTATGTGCAGAGCACTGTTCT
AAGCGCTGGGGTAGATACAGGGTAATCAGGTTGTCCCACGTGAGGCTCACAGTTAATCCC
CTTTATACAAGATAGTCGGATTAGACACAGTCCCTGTCACACATAGGGCTCACAGTCTTA
ATTTACATTTTACAGATGAGGGTACTATGACACAGAGAAGTTTAGTGACTTGCCCAAGAT
CACACAGCAGACAAGTGGTGGGGCCAGGACTAGAACCCATGACCTTCTGAATCCCAGGCT
TGTGCTTGATCCACTAAGCCATGCTGTTTTAGGGCCTATATCCCCTTCTAAACTGTAAGA
TTCTTGAGGCTAGAGATTGTGTCTACCTTGGCAATGTACTCTCCTTAGCCCTGCACTGAA
TAAGCACTCACTAAATATCATAGATTTAATTGTTCTTCTAGACTTTAAGAAGAGAAGCCT
CTCAGGCCCTCTTGGTAATCCATTCTAGTGTTAGGCAACTTGCATGTATGTCACATCTTC
AGTGACCTAAAAACTAACAAGATGTAACATTTTGAAGCCATCCCATACCTTTAATATTGG
AGTGGCTGGGAATTACATCGAAACCAGATTCAAGGGGGGAATGCATTTATCCGAGCTCCC
GTATTAATTGATTTTACCGTCCAAGAGGGAACCGTCGATTTGTAACAACACGATCCTCCC
ATCCACATTTACTTCCAAGTAGATTCTCAGGAGAGAGATACTAGTCCCAGTTGAACATTT
CGTCTTCAGTCCCCTATGAAATGAACAGACATGCAGACTTGTTCTTGGCAGATCGTTGAC
CCTCAGGAAGCTGGTTTTGGGTTTGGCTGTTTTATGACAAGCATCGCCCGCGGTGGATGA
GAGCCGTGTCCTCCCCAAGTTGCTGGAGGCATTACCATCTTCTCTGAACTCTTTTCATTG
ACTCAGGCTTGGGTCCCTTCCATTCCAGGAGTTAAGAGCTGTCCTGCTGAGGAAACATGC
TTCACTGAGTGACTTCCAGGCTGCTCTTTGCCCTGAGGGTTCCCTTGAACCCCCTTTCTA
TAAACAATAGTTAAGTCAGCTCTGCAAATCATTTTCAAAGGTCTTAACTGCAGGAGAAGA
TAATGGGGGGTTCTCATAGTTGGATGAAAGCTTGAACAAAATGACCTCTAACATGCATAA
GCCATATGTGGGCCTCTCTGCTGCCAGCTTATCTTAGCTAGCAACCCTGAGGATGCTGCC
GTCCTTGGCAGGGCAGAGCTGTGGGTTGAGAGATATCCAAGTGGGAGCTGGTCTGCCTTG
GGCACCATCTTGTGGAGACCCATCAGCCCCCTGTGGATGACAGGAGCTTGTATTTCTGAC
AAGAGATGAGTCTTGTTGGGAATTTTCATCCCCGGAAGGAGAGGGGAGCATCAAGCATCG
AGAGTGAGTAACAAAGTTGTGATCTGCAGTCGCCCCTGCAACTGAAGGCGGAATCTGACA
GATCATGCCAAAGCCACTTACTAATAATCTTTTCTGAACATGACTGTATTTAGGACAAAA
AATGAGAAATTGTTTTGGAATAATTTGACAGATATACTCTGTATGTTGAATAACTGAGGT
CAAGAGGTCGGGCGCCTCCTCAAAAAAACAATCCTTTTCTCTTTCTTGCTCTTTGGCTTT
CTCTTGGATATGTTTAGCTAAACCGGATCTGGATAAGGGTTCCTTTTTTTTCCGTAGTGG
TACTTGTTAAGCATTGACTACTTGCCAAGCACTGTACTAAGCACTAGGGTAGATACAAGA
TAATCAAGTTGGACACAGTCCATGTCCCCCATGGGGGTCAGTTTTAATCTCCATTTTACG
GATAAGGTAACTGAGACCCAGAAAAGTTAAATGTCTTGCCCAAGGTCACCCAGCTCCACC
ACTTGACCTCCCTGTCTTCTGTCTCTCCCTACTCCAGTCCATACTTCACTCTGTTGCCAG
GATCACTTTTCTAAAAAAGGTTCTATCCATATTTCCTCATTCCTCAAGAACCTCCAGTGG
TCATCAATCCAACTCCGCATCAAACAGAAACTCCTTGCTATTGGCTTTAAAGCACTCAAT
CAGCTCAGCCCCTTAAAAAAATTGTAAGTATGGTATATGTTAAGCACTTACTCTGTGCCA
AACACTGTTCTAAGTGCCGGGGTCAGTACAAGCTTATCAGTTTGGACACAGTACCTGCCC
CATATGGGGCTTCCAGTCTAGCCAGGCTGCTGACCCAACTCCCGAAGTCTTCTCTGGGTC
ATTTCATCTTTCAGGAGCTCCTGCCTAGGAGGGTCCTGAGGGTCAGCTGAGGGTCGTATT
CTCCCAAGAGTTCAGTATAATGCTCAGTACATAGTAAGGAATTAGTAATTACCATTCATC
AACTGATTGAATGGACTTAGAGGAATCGATTAAGTTCGACTTCTCTGTGGTAAACAGTCT
CTGTGTATCTCTTGGCTAGGCAAAGGAGACATCCAGTGGAGCAGCAAATACTGGAACTGA
CAGTTTGCATTTGGCCCGTCCACGTGAAGTGAGAAGTCGGAGCAATTAATGGGGGGGGTG
TATGTGTGTGAGAGTGTTGTGTAGCCTTGGCTATCCAGTTGGGTTGTTTACCTGGGGCAG
CTCAACCAGATGATTGCTGAATCCTCCACTTCACGTGGACTCTGCACACCCAACCACTGT
CTCTGTCCTGAAGCTGCACCTGCTTTAGTATCCAGTTTAATTTACAGTTTCTTGTTGGGG
ATGCTTTAGGAACCCAGAGTGCACTTGGCTTATCTGAGGGAAGGAGGGAGCTTTGCTTTG
GAATAATAATAATAATAATGGTACTTGTTAAGTGCTTACTATGTGCCAAGCACTATTCTA
AGCACTGAGGTAGATAGACGGTAATCAGGTTGGATGCAGTCTCTGTCCCATGGGGGCTCA
CAGTCTTAATCTCCATTTTCCAGAAGAGATAACTGAGGCACTGAGAAGTGAAGTGACTTG
CCCAAGATCACACAGCAGACATGTGGCAGAGCCGGGATTAGAACCCAGGACCTCTGACTC
CCAGCCCTATGCTATTTCCACTAGACCATGCTGATTCTACAAGAGAAGGGAAGGTGCCAT
GGATCTGAGGGTCATTTCTAGGCCCAGCAGCCTGGTGGGTCGGGGATGGAACAGACAGAC
AAGCATACACACACATACATCCTCCCCCAACCCCCCCTAGTAATCCACCTGCCCCTCCCC
CAGCTCTCCCTCTCACCATAAACCTGAGCCAATCCCCATTCAGTCCTGTCTGGTCTCAGT
CACCAAGCAGGTTTGGACCCAATCAGAGATTTTAAGTGTATGCACAGCTTGACCGTTATC
TAAACCAAGAGATTTACCACAGTGGGCTCTTTCTGGGTCCCCCTATTTATCCATTCACTT
ATTTATTTATATTAATGTCTGTCTCTCCCCATCTCTGACTGTGAGCTTGTTGTGGGCAGA
GAATATGTCTGTTGTTATATTGTACTCTCCAATGCTTTACACACAGTAAGCTCTCAGTAA
ATACGATTGAATGAATGAACCTATTACTCATTGCCTTCTAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1125, 29239..29340
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved