Ornithorhynchus_anatinus Locus RPL27A
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus RPL27A
Ornithorhynchus_anatinus
RPL27A
Contig2806
SNORA3
1414..1526
2974
acattccaagcgcttaatacagtgctctgcacatcgtaagcgctcaataaatactattg
aatgaatgaattctacgcatgttctaaaagtgcaggggaatggaagttgtgacagtcaca
cgattagaatcagttctttagaaacgatgggaatgagcggggagggatcggtctcgaggc
ttagagtcacatctggacacagcctgaagtcacggcgtgagagtcctcggagagtaaaac
ccgtctctttcatcttggggaccggtccctgggacggtgacagaaataatggccgtatac
gacttctggtgatggggtctcccttcgggggggtgcacctggggcccgagactttgggga
ccaagagcctgaccagaaaagccgattataacgactggctagcttcctctgttgcccacg
ccactcgtgtttctgcagggtgtggagttaaatgggagccaggcttgcgagtcagagatc
atgggttcgaatcccggctctgccacttgtcagctgtgtgactgtgggcaagtcacttca
cttctctgtgcctcagtgacctcatctgtaaaatggggattaaccgggagcctcacgtgg
gacaaattgattaccctgtatctaccccagcgcttagaacagtgctctgcacatagtaag
cgcttaacgaataccaacattattattattcaagggcatactatgtgccaagcactatag
taaccctgcgcggggggtagctagaagataatcaagtcccacgtggggcgcacagtctac
ataggagggcgaacgggtattgaatccccattttgcagatgagggaactgagtccggtga
agtgagttgcccaaggtcacacagcgggcaggtggcggagccaggattagatctcgggtc
ctccgccgcccccaggcctgagcgctttccactgggacacgccgcttcatgggcgagaag
ggtaaggtccgctagagtgaagctgattgacctggcggttcCACCTCCCTCCCTTTCATT
Caatagtatttattgagcgcttactatgtgcagagcactgtactaagtgcttggaatgaa
caagtcggcaacagatagagacagtccctgccgtttgacgggcgcacagtctaatcaggg
GAGACAGACAAGAACAATGGCAATCCACCCCGGTTACTTCGGGAAAGTTGGCATGAGACA
TTTCCACCTGAAGAACCAGAGCTACTGTCCCACGGTCAACCTCGGTAAGCTGTGGACCCT
GGTGAGCGAGCAGACGAGGGTCAGCGCCGCCAAGAAGAAGCCGGGCGTCGCCCCCATCAT
CGACGTCGTGCGCTCCgtaagccggaggggctgggtttccgccacacttcccgggtccgg
gcgggaggcggtcaccctggaaatcggtcttcccaccgagaccagagtcacatcctgaca
ccgttggttgtcccggtgtgcaagcgtcctcgcagagaatccccggctctttattcaccg
gctgaggtcaccggatcgggaacgtcatcattccagaaggaatttgttgtctagccagcc
cgcttgttcaagagctcctgttgtaggaggaacgtaaaatttacataatgatatacactt
atggccacgatgcgggtctgacggtgaccagaagccaagaggacctggggttcatagctg
atgggcagtaaagatgcatgtcaggagaaacctccggaagaaaatggtatctgggagatt
atttcagatcctgatttcgttccaggggttgggttagattatggttagcaggttgggaga
agactggcgtctttggcctcaccacctctcagtttcttttccttagGGTTATTACAAGGT
CTTGGGTAAAGGAAAGTTGCCCAAGCAGCCTGTCATCGTGAAAGCAAAATTCTTCAGCAG
GAGAGCGGAGGAGAAGATCAAAGGTGTCGGAGGAGCCTGTGTCCTGGTGGCCTAGaggag
tttaacattcctgccaggaacaataatcattctgtcggtgcctggctccttgggctctcg
ttttgtgctctttgtgcggattgggtcgcgagttgttcgtgggcacgtgattagggttga
acattctccctcggagctggggcggggggaaggaagtgggggaccctacctcccaagcac
tgcctcttcgggccggccgtggccctccagtcctattgagtaattgcacttttgtgatca
caaaatcttgaagccataagaatgtaaaaaagctctgggcctgtcactccccttcttaaa
aacctccagtagttgcctatcaacctccgcacgaaacaaaaactcctcactctaggcttc
gaggctctccatcaccttgccccttcctacctctcctcccttctctctttccactgccca
ccccgcacgctccgctcctccgccacccacctcctcaccgtcccccgttctcgcctatca
caccgtcgacccccgggccacgtcctttagtggaaagagcacggggttaggagtcagagg
tcatgggttctaatcccggatccgccacttgtcagctgtgtgactttggaaagtcacttc
gcttctcggtgacctccctggcactgcccttgttctcccccagaaaaattccaacccgtc
aacggcaacaccttcaacagagaagcagcgtggctccgtggaaagagcccgggctttgga
gtcagatgtcatgggttcgaatgccggctcagccacttgtcagctgtgtgactttgggca
agtcgcttcacttctcggtgcctcagttccctcatctgtaaaatggggattaagactgtg
agccccatgtgggacagcctgattcccgtgtctatcccagcgcttagaacagtgctcggc
acatagtaagcgcttaacaaataccaacattattaacacctgtgaccaacacatataatc
aggagagaaattcaactaaaaataaaacacacctc
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1020, 1140..1335, 1846..1974
1001..1020, 1140..1335, 1846..1974
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved