Ornithorhynchus_anatinus Locus Poly:SNORA7
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Poly:SNORA7
Ornithorhynchus_anatinus
Poly:SNORA7
Contig27981
SNORA7, SNORA7
1001..1140, 1891..2030
3030
aatagagcgggggttccagaggccacacttgaaagtagctgtgggtgcaagggcaggag
cggggggaagggcgggggtaggggagggtttggatgcgaaggaggtggcggggccctgga
cggggagagggggatgaggggtggcggtgggacaagaggactgggatggggcatgggtgg
ggaagagagaagggggaagggggtgaagagggggtttggtggggggaagagtagggggag
ggggaagaggggtcttgtctattttgccccctacctcatgcccacttcctgcctctttcc
tggaatgccttccccagtcatatctgaaagaaagttactctcctcatctttaaggcctta
ttgaaagcacttctccagaacactgtactttcctaagtgcttagtcctctgctcacagta
tgcgctcaataaatatgattaaatactctcaactgtccacttaaattggtgttgttcaga
actacaccaagttttgtctaattcacaaattaccttttaaaaatcaaccccactgacaat
ctagttccctacagggtcataaaataaacaagatagcatcttatcacattctttttatag
tggaatgactggctgctcatattcatattattttatatttttaatgataattttgttttg
gttatttgttttttagttatggtttttgataaaggcttaatatgtgccatacaagctaat
caggttaatcaccatctgccccacttgtggctcaaagtcttaatcaccattttacagctg
aggcacagagaggttaagtgacttgccagaggtcacacagcagaacctcttatgcacagg
gaatatgtctgtttactgctgaattgttctatctcaaacacttagtacagtgctctgcac
acagtaagggctcaatgaatgcaaatgactgacaaatggcagagctggaattaataataa
taataataataataataattgtaattatagtacttgttaaatacctctctcagggtgaca
cctaaagagtttccagtactctaccattctcgacttcagacgggagaggcaaacagaggc
atatccattccattcctaggttggccagtggctagcgagtgacaggtaatctgctaaaat
caaaagtcccctgtgctgggcagcagcagcatgggagagagtcgagggtggagactcagg
tttactgcgtggaaggacgcaatggtaaaccacttccatacttttttttaccaagaaaac
tctctggatccactaccagaatgattgctgatgcaggtggggcatttggggaagcagcgt
ggctggggaagcagcgtggctcagtggaaagagcctgggcttcggagtcagaggtcttga
gttcgactcccagctctgccacttgtcagctgtgtgactgtgggcaagtcacttaacttc
tctgtgcctcagttacctcatctgtaaaatggggattaactgtgagcctcacatgggacg
acctgattaccctgtatctcccccagtgcttagaacagtggtctgcacatagtaagcgtt
taacaaatacaacattattattcggggagacatgtgtccatggcatcactatgggttgga
gaggactcaatggcataagacttattaagtgcttactatgtgccaagcactgttctaaac
atttactaattgctaaacactgttctaaccactggaatagacacaaatttaattggggtt
gggacacagtccttgtccccacatgggggctcatacctccttaatccccnnnnnnnnnng
taagggctcaatgaatgcaaatgactgacaaatggcagagctggaattaataataataat
aataataattgtaattatagtacttgttaaatacctctctcagggtgacacctaaagagt
ttccagtactctaccattctcgacttcagacgggagaggcaaacagaggcatatccattc
cattcctaggttggccagtggctagcgagtgacaggtaatctgctaaaatcaaaagtccc
gtgtgctgggcagcagcagcatgggagagagtcgagggtggagactcaggtttactgcgt
ggaaggacgcaatggtaaaccacttccatacttttaccaagaaaactctctggatccact
accagaatgattgctgatgcaggtggggcatttggggaagcagcgtggctggggaagcag
cgtggctcagtggaaagagcctgggcttcggagtcagaggtcttgagttcgactcccagc
tctgccacttgtcagctgtgtgactgtgggcaagtcacttaacttctctgtgcctcagtt
acctcatctgtaaaatggggattaactgtgagcctcacatgggacgacctgattaccctg
tatctcccccagtgcttagaacagtggtctgcacatagtaagcgtttaacaaatacaaca
ttattattcggggagacatgtgtccatggcatcactatgggttggagaggactcaatggc
ataagacttattaagtgcttactatgtgccaagcactgttctaaacatttactaattgct
aaacactgttctaaccactggaatagacacaaattaattgggttggacacagtccttgtc
ccacatggggctcatactcctaatccccactttacagatgagcaaactgaggaccagaga
agtgaagtcattcattcattcaatcttatttattgagcctttactatgtgcagagcactg
tactaagaccttagaaagtacaattcgacaacagagacaatccctacccaacaatgggct
cacccaaagtcacccagcaaatgagtggcagagtcctggtccttcttacttccagggcca
tgcttgtccactaagccatgctgtttggattagaacccaggtcctaggactcccaggaca
gtgttctttccactagccatgctgcttctctgtatctctctctccctaattatctctctc
cctaaaaagccccagatagtttctctttgct
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved