Ornithorhynchus_anatinus Locus Poly:SNORA33
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Poly:SNORA33
Ornithorhynchus_anatinus
Poly:SNORA33
Contig278044
SNORD100, SNORA33
288..372, 640..773
955
CCACAGACTTTGGGTGGAAGTTCAACGTCCATGTCTGGGAGCCAGCCATCGAGTCTCCG
ACCCATGGGCGTCTCTCTCCCAGAGTGTTCCGCTTCCCATCTGCAATCTGGTAGTGTGAA
ATTCATTCAGAACGCGGCTTCAAAGGAAAAAGGGATAGCTTAGATCCAGGGTGGACAAAC
GGGTGGTGTCAGGGGTGGGAATCCAAGATTGATTTCTCAGCTGATAGTCCGGCAGTGGCA
AGTTACGTATTCTGGCTTGGTGAAATAGCAGGTACACGGGGTTCTGGTGCTGTACATGAT
GATAGCTTGGCTCCCTCTACTGAAAATGGTGAGGATAATAGCCATGTCACCCAATATTAT
CTGAACGTACAGCCGCTTGAATCTCCCCATCTGATAGGTTTGGAGTTGTGCAGCATATTC
ATTGTAATTAATTTACACAACAGGTGGACGACAACAAGAAACTGGGTGAATGGGTAGGCC
TCTGCAAAATCGACAGAGAAGGGAAACCCAGAAAAGTTGTGGGCTGCAGCTGTGTGGTTG
TCAAGGTAAGCGCTCTAATTGTCAGTGGGATGGGGCAGAGGAAAACCGAGATGGCTGCAA
TAAATCATGGGTTCTGGTTTGCAAATTGCCAAAACCCTATAAGCCAGTATACTTCATCTG
CTTAACTGAACGTGTTTTGCAGAAGGGATGTGTGAATATGCTGGCAATATCATAGCCTGG
GTACGAGCCTTGAAGACTCTGTAGTCATTAAGGTCCCTGAAATTGGCAACATCTCTCTAC
AGCCTCCATCCGTGTTATATGCCGGGGAGCCCGTTCCCTCCTTGGCCCTGGCAAGGTAAA
TCGCACCTGATTATGCCTACATTTTCCCCATTTGGACACATGAAAGAAAATGCCTGTCCT
CCACAGTACAAGTCAGTTGAGTTGGGAGAAAGGACAAAAACAAGTTGGCCTGTGAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved