Ornithorhynchus_anatinus Locus ENSOANG00000015366
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus ENSOANG00000015366
Ornithorhynchus_anatinus
ENSOANG00000015366
Contig27359
SNORA5
2684..2818
5369
AGGGAACTGAGGCCCAGAGAAGTGAAGTGAGTCGCCCACGGTCACCCAGCTGACACGTG
GTAGAGCCGGGATTCGAACCCATGACCTCTGGCTCCCAAGCCCGGGCTCTTCCCGCTGAG
CCACGGTTTTTCTCTAATGCTGCTTTTAATGCTACTTGCTAAGCGCCTACTACGTTCCAG
GCGGTGTACGAAGCGCCGGCATCGGGCCCACCTAAGCCGGCCGGTCCCAGTCCCACGTGG
CGCTCACAGTCTCCACCCCCATTTTCGGGGCGAGGCCCGGGGAAGGGACTCGGCCAAAGT
CATTCGGCAGGCCGGGATTAGCACCCAGCCCCTTCTGACGCCCAGGGCCCTTCCCGCCAG
GACCCCTAGAAGCAGCGTGACTCAGTGGCAGGAGCCCGGGCTTGGGAGTCCAGAGGTCGT
GGGTTCGAATCCTGCCATTTAGCTGGGTGACTGCGGGCGAGTCACTGCACTTCTCTGGGC
CTCAGTTTCCTCATCTGGACAATGGGGATGAAGACTGGGCGCCCCACGTGGGACAACCCG
ATGACCCTGTATCTCCCCCAGCGCTTAGAACGGTGCACTGCACAGAGTAAGCGCTTAACA
AATACCATTATTATCGCCCCTCGACCTGACCGCGTCTCCTGGGCCTCGGTGGCGGCTTTT
TCCGCACCGCGTCCGGCCCCCGGCTTCGTCCTCGGACCTTCCTCCTCCCTCCCGTCGGAG
CCGCGGCCCTGCCCCCGGGGAATCCGGCAAACGGAGCCATCCGCCGACCCTTAAAAAGAA
TAATAATTACGGTATTTGGGCGGTGACTACATCCCAAGCACTGTACTGAGCGCTGGGGTG
GATACAAGATCATCAGCTTGTCTCTAACACCAGACTGTCTCTCAAATTGGCCCTTCCAAG
CGCTTAGCACAGCGCTCTGCACGTAGTAAGCGCTCGATAAATACTATTGAATGAATGAGC
TAAGCGCCGTGTGGGCCGGGAGCCTGTCGACCTGCTGTACTGTTGTCTCCCAGGGCTCTG
AACGCAGAAGGTGCTCAGTAAATACCGCCGATCGATTAGTTACCACGTGGGACTCCCAGT
TTAAGCAGGAGGGAGAAGAGGGATTGAGTGAACCCCAGTTTTTTTTAATGGTACTTAAGT
GCTTGCTATGTGCCAGGCACTGTGCTAAGCGCCGGGGTGGATACAGGGTAACCGCCTCGG
ACACCGTCCCTGCCCCACCCGGGCCTCACGGTCTCGATCGTTTTTCCGACGAGGGAACTG
AGGCCCAGAGGAGCGAGGTGACTCGGCCGAGGTCCCCCGGCAGACGAGTGGCTGAGGTGG
GTTTCGAACCCAGGTCCTTCTGACTCCCAGGACTGGGCTCCACCCACCAGGCCACGCTGC
CTCAGGCTCCTTCCGGGGCGACCAGAACATAGGCGGGGAGAACCCCGGCTTCCGTGACGG
TGGGGCGGGCTTCCCCGGGCCCCCTTTCTCCCCCCCCCGGTACCTTTCAACCGTCAACTG
GCCTGTGGGCCTGGAACGTGTCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTACA
GCCCCCGATGGGACCCCGGACCTGGTTTCGGACCGGCCCCGGACGCCCCCGCTGGGACCC
CGGCCCCACCGCGCCCGGGCTCCCACCCTGTCGGCGGCGGGCAGCGGGTTCCCCGAGAAG
GGAGCCCGGTGTTCACCCCGTTCCCCCAAGAGCCAGCCGGCGGACCGGCTGATCGAAGCG
GCCTCCAGCCCCGAGCAGGTGCTGCAGCTGGTGCGCTGCGGCCACCCGCCGCACCGGAAC
CAGGCCGCCCTCATGCTCGTCCGGCTCTCCCGCCTCCTCGCCGAGAAGCGCCAGGACGCC
GGCCCCCTCGTCCGGGACGCCCGCTTCCAGGAGCTGCTCAAGACGGTGCACGGCCAGGTT
GGGTCCCGGGGGCGGGGCGGGACGGGGCCGTTTCCTCCTCTTTGTGATTATTTTTAACGG
CGTCCGTTCAGCGCGTACCGCGTGCCAGACGCCGTAGCGAGCGCTGGGCTAGATAGAAGC
TAATCGGGCCGGGCACAGTCCGTGTCCCACGTGGAACTCACGGTCTTGTCTTATAATAAT
GATCTTTCGAAGCGCTTCCTCTGTGCCGAGCACTGTGGTGGAGACGAGCTAATCAGGTTG
GACACGGTCCCTGTCCCGGGAGGGGCTCGCAGTCTTCATCCCTCTGTGGCGGATGAGGTA
GACGAGGCCCAGAGAAACGAAGGGACTTGGCCTAGGTCACCCAGCGGACACGTGGCGGAG
CCGGGCTGAGACTCCGGTTCCTTCTGACTTCCAGGCCCGGGCTGTAGCCACCGAGCCACA
CCGCTTCTACTCTGTCTTCTCCTTCTCCCATGTGGGCAGTACGGCGTCTAGCATAGAGTA
GGCACTCGGTAAATACCGCCGACTGATCGCTAGATCCGGAGGGTGCTGGAATCCGTGGGC
TCGGGTCGGACACCCGTCCCATCCCCAGTCAGTCAACTGTAGTTATTGAGCGCTGGCCGC
GTTCAGAGCATTATACTAAACGCTTGGGAGAAGACAGTGGGATAAAACAGACACGTTCCC
TCCCCACAATGAGCTTAGAGTGTTTTTCGGGGGGGGCGGTGGAGGGGGACAGACCTAAAT
ATAAGAAATGACCGACACGGATGTAAGTCGCCCTGAGATTTCCCCGCAGCCCCGTCAAAT
TCGGCGCCCGCCCCCTCCGTGGCCGGCGCCGGCCCCAACGGCTGCCACAGCAACGCCGCG
GCCCATGGCCCCGCGACCCGCTCCCCGGGGCCCGGGGATAAATATCGCCGCCGACACAAC
CGGGACGGAAGCGGCACCGCCTGGCAGAGTCGGCCCGCGCCTGGGGCTCAGAGGACCCGG
GTTCTCGTCCCGGCTCCGCCACGCGTCTGCCGTGTCACCTTGGACGAGTCGCCTCATTTC
TCCGTGCCTCGGTCACCTCACTGGCAGAACGGGGACGGAGGCCGGGAGCCCCATGGGGGA
CGGGGACCGTGCCCGGTCTAATTAGCCGGGAGCCACCCCGGCGCTTAGCACGGCGCCCGG
CCCGCGGGAAGCGCGTCACGGACACCGTAAAGAATAAATCCGTCCGCTGGGGAGCACAGC
GGGGCCACCGGGGTCAGTCTTCGAGGCAGGAAGACAGGCTGCGGCCGCCCGCCGCTCTTC
GATCCCAGAGATGCCCCGGGGTAGAGGGGGGTCGTTCGGTCAGGCTTATTATTGAGCGCT
CACTGCGCGCAGAGCATTGCGCTAAGCCCTCGGGAGAAGTCCGTATAACAAGAGACGCAT
TCCCTCCCCACAAGCAGCTTACGGTCTAGGAGGGCGTGGGCGGGACCCCGGGACTCCTTT
CCTACCTCGGATCCCGAGGGAACGGTCTCCCTGGGCGGGTCATCGGGCCGTCGTATTTTC
CATCGGTGGTGTTCCCGGAGCGCTCACCACGGGCGGAGCGCTGTACGCTAAGCGCCGGGG
AGAGTTCGGCGGGACATCTGGCCGAGGGAGCGGGGGCCGCCGGGCCTTCCGGGAAGAGCG
GCCGGCTGGGTCTCACCGAGGAGATGGGGGGGCGGGGGTCCTCGCAGATCTCCCTGGTGT
GGAACAAGACCCTGGTGATCCTGCTGCGGAGCCTGTACTCGCTGCGCCTGCCCGACGACT
GCAAGGAGCTGCGCTCGGTGGAGCAGGAGGTCTGCTGGCGGCTCCGGCGCCTCAAGTTCC
GCCACCTGGCCTTCCTGGCCGAGACCACCGTCCCCTACCTGCAGGAGCGGCGCTCCGACC
TGCTGGCCGAGCTGCTGCTGCACCTGGAGCGGCGCTGGGCCGAGATCGACGACTGCCGCA
CCGTGGTCTCCCTCCTCACCAGGGTGGGCCACCTGTCCGAGGCCCTCATGGACCGCCTCG
AGGACAAGGTAGGGGGGGGCGCCGGCCGGCGGGCGGGGCCGGCCTCGAGGAGAGGCGGTA
TCGGGGAGCGTTTACTACGCGCCAGGCGCCGTACTAAGCGCCGAGGTGGATGGCGGTGAC
GGGGTTGGACACGGCCCGTGTCCCACCTGGGGCTCCCGGCCTTAATCCCACCGTACGGAC
GGGGGAACCGAGGCACGGAAATCGAAGCCACTTGCCCACGGTCACCGGGCGGACGGGGGG
GCGGAGCCGGGACGTGACCCCAGGTCCTTCTGCGGCCCGGGCCCCGGGCTCCAACCGCTA
GGCCACGCCGCCGTCCCCCGGGCCGGCCCAGGCCGGTCCCCGGCGAGCCCGGGCCCGGCT
GACGGTCGCGCGGGGGGGGTCGGTGTGGTCGCCAGGGCCTGGAGCTGGTGGAGCAGTTCG
GGGCGGAGGACCTGCGCAGAGTGCTGCTGGCCCTGGCCCTGCAGAACCGACGCTCGGTGC
CCCTGCTCCGCGCCGTCTCCTACCACCTCATGCAGAAGCCCTTCACCCTCAGCAAGAGCG
TCCTCATCGACCTGGCCTACGCCTACGGTGAGACGCCGCGCCGCCCCCCCCCCCCCCCGG
CCCCGGGGCCGAATCGGGGACGGGCGGAGGGCGCCCCTTCCCGACCCCCCCGGCCCCGGC
TAAGAACCCCCCGCTCTCCTCTGCCCTGAAGGAAAGCTAAACTTCCACCAGACGCAGGTG
TTCCAGAAGCTGGCGGCCGACCTGCTGCCCCTGGTGCCCGGCATGTCGCCCAACGACGTG
GCCCGCTGCGCCAAGTCCTTCGCCTTCCTCAAGTGGCTCAACCTGCCGCTCTTCGAGGCC
TTCGGCCAGGTGAGCCGGGCGCCCCTCCTCCCCCGCCCGCGGGCCCCGGGGGGAGAGGCG
CCCGCCCGCTCCTCATCTCCCCCGTCCTCCGTCTGCCCCCAGCACGTTGCGGGAAAAGCC
GCTAGCTTCACGCCCCAGCAGCTGTGCAACGTGGTCCTGGCCTTCGCCCGCCTGAACTTC
CAGCCCGAGCCCCAAGACCCCTTCTTCTGCGCGTTACGGCTCCCTTCCCGGGGAGCTTGA
CGGGGGCGGGCGGGGTCCAGGGGGTCGGGTCGGCTGAGCTGCGGGCGGCGGGGATGGGCC
TCTGTTCTTTTCGCTTGGGCAAATATGAGTTACTCATGTTGGGCGGAGTCTCTATCCCCC
AACTTCTCTCTCTTTCTAATAAGGTATTAGGAGAGGCTTTCAATCCCTATCTAACATTTC
AGAAAAATGAGGAATAGATTATTTTATTGACAGGTCATGGGTTCGAATCCCTGCTCTGCT
ACTTGGAACCTCTGTGAACCCGGATCAATAACTATATCTTCTCTGGGGCTGAGTTACCTC
TATCTGTAAAATGAGGATTAACTGAGAGTCTCACTTAGAGACAACCTGATTACCCCTGTC
TCTGAACCAACGTTTAGAAACGATGCTCTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1065, 1556..1916, 3587..3905, 4293..4466, 4591..4748, 4842..5010
1001..1065, 1556..1916, 3587..3905, 4293..4466, 4591..4748, 4842..4946
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved