Ornithorhynchus_anatinus Locus ENSOANG00000015418
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus ENSOANG00000015418
Ornithorhynchus_anatinus
ENSOANG00000015418
Contig27027
SNORA14
10270..10409
15808
CTTCGTAGAGAAGCAGCGTGGCTCAGTGGAAAGAGCCCGGGCTTGGGAGTCCGAGGTCA
CGGGTTCGAATCCCGACTCCGCCCCGGGTCAGCCGCGGGACCGTGGGCCAGTCACTTCAC
CGGGCCTCAGTTCCCTCATCTGCAGAATGGGGATGAAAAGTGGGAGCCCCACGTGGGACG
ATCTGATAACCCCGTAGCCCCCCCCCCCCCCCCCGGCGCTTAGAACAGTGCTCTGCACAT
AGTAAGCGCTTAACAATTACCCACGTTATTATTGTTGGCCAGAATCGTGGTTGGGTAGTG
CTGTCGCAGGCTCCCCTGAGCGCTCGGTGCAGCGTTGCGCGCCCGGGCGGCCCTCGGTTA
AAACGCCCGCGTGGGTGACGTTGAGTGAGTGTATTGTTGCCGAATTGGCCATTCCGGGCG
CTTAGTACAGTGCTCCGCCCATAGTAAGTGCTCAATAAATCCCGTTGGATGAATGAAAGG
ACGGCCCCGCAGCCTCTCCCCGTCGGGGCTAAAGGGGAACGGGCTGGGGGCGTCCCCCCC
CGCCCCCCCCGGGCCCCCCGAAAGCACGCCCGCCCCGGCCCTGAGCCCGTCGGTGCCCCC
TTTCCAGAACTCGAACCTGGTCCTCCACGCGGACCGCTCCCTCATCGACCGGACCCGCCA
GGACGAGCCGACGGGAGAGGTGCTGTCCCTGGTGGAGAAGCTGGATGGGACCCGCATGGG
CGACAAGGCCCATAGGACCACGCCGCACATGCTGGAGGAGAGACGCGCCAAGTGAGTGGA
GCCGCCCGGCGGGGTCCCCCTCTGGGGCGAGCGACGCCCCGAGTCCCGAGTCGCTCGGGT
CCGATGACCCGTCCGATGCTGGCGGGGCAGGGAGAGACGACGGCTCCTCGTTTCTAGCTA
TCCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGAAGGAGAAGGTAGCGGG
ACAAGGAGAGACGCAAGGAGATCGACCTGGCTCCTGGGCCAGACCGATGACACCCGCTAC
CATGTGCTCGTGAACCTGGGCAAAAAGATCACGGACTACGGCGGAGACAAGGAGATCCAG
AACATGGGTACGGGCCGCCCCGGGCTCTGGGGCGTGAGGCCTGGCCGGTGGCCTCGGGGA
CCTCATTCACGGCCCCGGCGGCCTCGGGGGGTCCCTGGCGGAACGCTGGGCTGGGGGAAG
GACCTTAGATGGGACTCGTGAGGAATCGCGTAGCGAGTCACGGCGTCCCCGGCGCCTTCT
GACGCAGATGGGTCCTAGCGGCTCGGCAGAGCGCGTGGAGTACGGGCCCGGGAGTCGGAA
GGTCCTGCGTTCTAATCCCGGCCCCTCCACTTGTCTGCTGTGCGGCCTCGGGCCAGTCAC
TTCACCTCTCTGGGCCTCGGTCGCCACGTGTGTAAAATGGGCCAGGGACCGCGTCCACCC
CGATTCGTTTTTATCCACCCCGGCGCTTCCTGACACGCGGTAGTCCCTTAACGGATACCC
CAGTCGTTCTGGTTATTGTCTGGGGTTGGGCCGTGTGGCTGAACCTGTGGCCCTTTCTGC
CGCTGACATTTCAGTCAAAGAAAGCCGGAGGTCCTAGGACCCTGGGCCCAGGGAAAAGGC
TGGCCCGTCGGAGGGCCAGGCCCGTAACCGTCACCCCCATCCTTCCTCGCGCCGGCCCTG
CCTTTCTTTTTCCGATCTCGGCCCCGTCCTCCTTTGCAGATGACAACATCGACGAGACCT
ACGGTGTGAATGTCCAGTTTGAGTCTGACAAGGAGGTGAGTGGCCGGTTTGGAGTAAGGC
CAGAGCCCCGCTTTTTCCCGCGCGGTAGGGAGGGACTTCCGCACGTCCTNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTTGCCAGAGCGA
TTCCGAGAAAGGAGAGGATCATGGGGAAGATGGAGTCCGATCCCGAGTTATCCAAATTCC
TCTACCAGCTCCACGAGACGGAGAAGGAGGATTTGATCCGGGTGAGGATGGGCCCTCTCC
CCGGGGATCGCCTAACTTGGAGGATTCGCCCCGGCGAAGGAGCAGCCGGGGCGCGAGGCG
GGCTCCCCGGGGAGCGGGGAGGTGGAAGGAATGGGACGCCGCGGAGAGCCGGGCCCCAGA
ACGGAGCCGGAGGGGTCACGTCGGAGGAAGGCGCCGGGCCGGAAGCCGATCGACGGGCTG
TCGGCCGTTGGTTTCTTACCGGTGGCTCACGGCGCCGTCCCGTCGGGTCCCTTGTCCCGG
CCGGGAAGCTGAAGGTCGGGGTGGCGGGGGGGGGGGGGGGTCGCATCTGTCTGTCGGGGA
CTGTGGCCCGTTGACGCGTAAGCCGTCTCCGTCGAGCTCACCCGAACGTTTTTAGACTCC
TTCCCAACGGCGAAGCTCAGGGGCGTTTCGGTGGAGGCCGGCCAGATCTCCGAGGGGGCC
TTCCAAGAGCCCATCTTCGACCCTTTCTCCCTCGCTCATCCGCCCGTCTCTCGACTCCGG
CGTTCCCGTCGACACGCCGAGGGGAGCGGCCCGCTGCCGGACCGCGCCCCTCCGCTCCGG
ACGCCGCGACGCGCCCGAGCCCGGGGAGCCGCCGCCCCCTTCGGGGCGGAGAGATGTCGG
TCGGAGGAGGTCTCTGACCCACCGTCTCCGTCCGCCGTAGGAGGAACGTTCCCGGAGGGA
GCGCGTACGCCAGTCCCGGATGGATACGGATCTGGAAACGATGGATATGGACCAGGGGGG
AGAGGTGAGCTTAGGGCGTGGGGCGACGCCCGGGAGGGCCGCGCCAGAGGGGAAGGCAGG
GAGGCGAACTCGGCCGTGCGTCCCCCGTCGGTCTAGGTGCTGGCCCCACGGCAGGTTCTG
GACCTGGAGGATTTGGTCTTCACCCAAGGGAGTCACTTCATGGCCAACAAGCGCTGCCAG
CTCCCCGACGGATCCTTCCGCCGCCAGCGCAAGGGATACGAAGAGGTGCACGTGCCCGCT
CTGAAACCGAAACCCTTCGGTTCCGAAGAGGTAAGCGAGCCCTCCGCGCTCCTCCCCGCC
CCCGCGGAGCCGCTCGGCCGGCCGTCGGGGCGGAGCGAAGGCTTAGGTGCGGCCCCGTCC
CATCCGCCTCCCGGCTGGTTTTCGGCGCGACGTTGCAGCCCCGGGAATCCCGCGGGGGTT
CCCGTCGGTTGGGTCGCGTGGGGGTCGGCCGGCCCTCCTCGACCCGAATGGATCTCCTTG
GCGTCGTCCTCTGCAGCAACTGGTTCCGGTGGAGAAGCTGCCCAAATACGCCCAGGCCGG
TTTCGAAGGCTTTAAAACCCTGAATCGCATCCAGAGCAAGCTCCACCGGGCGGCCCTCGA
AACCGACGAGAACCTCCTCCTCTGCGCCCCCACGGTAAGAGACGGCTCCTCCTCGGGGCC
GCCGCGCCGCGGGGCGGGGGGGTTGGGGGGGNNNNNNNNNNCCCCGGGCCCCGGGCTGTT
CCCTCCTGCCCGGTGACCGGGAAAGGAGACCGTCGTCTGCCGCCAGGGCTAGCGGGACGA
GGTCCCGTGCGGTCCCCGGGAGCCCCCGGGACGGCCATCTCCCGGCCCGGCGGGCTCTGG
GAGCCCGAAGGAGCCTGGGGCCGGGCGAGCGGGCGCCGCGCACGGCGCTCCGCGTAAAGC
CAGTGCTCGTTAAGCACCGTCGGCCCACTGCCCGAGACCCCCATCCGCGGCGGGGAGCCG
AGTCGGCTCTCGGGGGGGGCGAGAGAAGTGAGCTCCCCGCGGGCAGGGAAGCCGCCTACC
AACCCGGCTGCGCCGGACTCTCCCGAATGCCGGGTCCGGTGCTCCGCGCCCGGAAGATTC
CACCGATCGATGGGTCGAGAGAGAGGAGGAGGCGGCGGCGGGTGAGTGACGGTGCTGTCT
CTGCAGCTGGTGGCCTCGGGGGAGCTGATGAGTTCCAAGAAGAAGGACCTGCACCCCCGG
GACATCGACGCCTTCTGGCTCCAGAGGCAGCTGAGCCGCTTCTACGACGACGCCATCGTG
TCCCAGAAGAAGGCCGACGAGGTGCTGGAGATTTTAAAGGTAGGCCGCCGGGGCGTCTCG
GGACGCGGGAGGGGCCGGAGCTCCCGGGACCGAGAGCGTCTCTGCCCGGGGTCTCCCCGG
AGGGGCGGTGCCGGGGAAGCGCGGTCGGGGCTCGTGTCCGCAAGCGGCCCGCGTCTCCCC
GCAGACGGCCGGCGACGACAGGGAGTGTGAGAACCAACTGGTCCTGCTCCTCGGCTTCAA
CACCTTCGATTTTATCAAAGTTCTGCGGCAGCAGAGGATGATGAGTGAGTACCCGGCGCC
CGTGGGGCCGGCCCGCTGGTCGCCCGCCCGTCCGTCCCAAGCGCTCGAGCACAGTGCCCT
GCCCGCGGCGAGCGCTCGGTGGAGCCCGTGGGTGGATCGACCGTTGGCGCGGGCGGTTGC
GATCTCGTGCGTCCTCGCCTCCTTTCCCTTTGCCGCTCCTCCCCGGCCCCAGCTCACCCT
TTCCCCTTCTCTTCCCGCCTACAGTCCTGTACTGTACCCTCTTGGCTAGTGCCCAGAGCG
AAGCCGAGAAGGAGAGGATCATGGGGAAGATGGAGTCCGATCCCGAGTTATCCAAATTCC
TCTACCAGCTCCACGAGACGGAGAAGGAGGATCTGATCCGGGTGAGGATGGGCCCTCTCC
CCGGGGATCGCCTAACTTGGAGGATTCGCCCCGGCGAAGGAGCAGCCGGGGCGCGAGGCG
GGCTCCCCGGGGAGCGGGGAGGTGGAAGGAATGGGACGCCGCGGAGAGCCGGGCCCCAGA
ACGGAGCCGGAGGGGTCACGTCGGAGGAAGGCGCCGGGCCGGAAGCCGATCGACGGGCTG
TCGGCCGTTGGTTTCTTACCGGTGGCTCACGGCGCCGTCCCGTCGGGTCCCTTGTCCCGG
CCGGGAAGCTGAAGGTCGGGGTGGCGGGGGGGGGGGGGGGTCGCTCTGTCTGTAAGAACG
GGTGTGCACCACACCCCACAGAATCCACAAAGAACTATCGATCTGTCAATTCTTTCCGTG
TCCGGGCCGGGTGAGGTTTCCCGTGTTGAGTCGAATTAAGCCGCATGCTCCACTGCTGCT
GGTGCCCTTCCGTCTATTACTCTATGTTTCAGCTTTGTCACCCATACTCTCCCCCGTAAC
CCAAAGACTTTGGATTTCCCGGAAGGGCTGCGCGGCGGTGTCATGAGAATAACNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNGGGCTCGGTCACCTCACCCGTAAAATGGGAATTAAG
ACCGCGAGGCCCGCGGGCTTCGACCCTCTCGGTAGCGTCGCCGGGAGCTTCGGAGATGCG
AGCGAACGCGGCGGGAGACTGCGGGGCGATCCGGGGCGCCGGGCCCATCTCCTGGGGCCC
GGCGTTCTTTCACTAAAACTGAAACGGCTCTCTCCGAGACGACGACCACCGGGGTCGCAT
CTACCCGGCCCTTAGAACGGCGTAGGAGCTTAACGGGTACGATTTTAAAAGGAACAGGGT
CGCTTCCTCAGCCTGCGGTCTGACGGAGATGATCGGGAACGAACGTGGCGTCGGTCTAGT
AGTGAAGCTCCCCGAAAAGAAATGGGATCTCGGGGCAGCCCCCAGAGAGGGCGGCTCCGA
TTTCCGCCACGGAAGCGATCCCTCTCGGGACGAGAGAAATCTCGTTTCATCTTGTTTCTC
TGCCCCGGAGATGGTGGTTTCCCCTGGGGTTTGCCGCCCTGGGCGAGGGAGTGACCGTCA
CCGCGAGGGTAGCCGTTCGGCACTCGCTCTATCCTGAGCGCCAGGATGCTTCCAGGGTTA
TCGTTGTGGGGCTTCCGGCGAACGGGACCCTTTTCTCCCCGTTCCCCCGGGCGTCCCGGG
GAGGTTCCGCTGTAGTCCCAAGCAGGACCCCGCCCCGGCCGTTCGTTCGTCTCATCGTCG
TGTTTACGGAGGTAGGGAGGGTAACCTGTCGGATTCGGGGAGGGAGGGCGTTCCGGGCCA
GAGGTGGCACGTGGGCCGGGGGGAACGGCGAGGAGGTCGGCGCTACGGGAGCGAAGCGTC
GCGCCGGGTAGGAGCAGGAGAGAAGCGAGGCGAGGTAGGAGGAGGCAGCGTGATCGAGCG
CCGTAAAGCCAGCGGTGAGGAGCTTTCGCTTGATGCGGAGGCGGATGGGCGACCGCTGGA
GTCTTCTGAGGAGCGGGGAGACGGCTCCCGAACGTTCGCGGAGGGGAAACGAAGCCGCGG
CGTCGAGCGTGGTCTGGGGCGGGGGAGCCTGGCGGGTCAGCGGAGGGGCTGTCGCGGGCG
GGACAGGGCGAGCGGTTTGGACGGAGAGGAGGGGCCGGGCTTTAGCGAGGCGGTTGGTGG
GACAGACGGGATCCGGCGGCGGATCGAATGTCCGGGTTGGACGAGAGAGGGGAGTCGAGG
ACGGTGCCGCCGCGGTCGGCAGCAGCCCGGCGAGCGGGGAGAGCGGGGCCGGCGCCGGGG
TCAACGTGGCGCCGCGTGTCTCCCCCCCCCGGGCCTCAGGATGAGATCCATCTCCTCCAC
GATGACCGAGGGCCCGTCCTGGAAGCGCTGGTGGCCCGGGCCATCCGCAACATCGAGATG
ACCCAGGAGGACGTGCGGCTCATCGGCCTCAGCGCCACCCTGCCCAACTACGAGGACGTG
GCCACCTTCCTGCGCGTGGACCCCGCCAAGGGCCTCTTCTACTTCGACAACAGGTGCTGG
GGGGGTTGGGAGGGCGAGGCGGGGGTGGGGCGGGAGCGACACGGCGCGGGGGCGCCGGCA
GAGGGGGAACCCGCCCCTGGAGGTGACGGAGATCCACGCCGGGCCCACCGTTTCTCTCGG
GAAGCAACGTGGTCTGGTAGAAGGAACCCCGGGCCTGGGAGTCCGAGGACCTGGGTGCCA
ATTCTGGCACCTCCCCTCGTCTGCCGGGTGGCCTCGGGAGGGCCCTCTGGGCCTCGGTTT
CTTTATCGCTCAGAGGGGGATTCGTTACCCGTTCACCCTCTTGCTTAGACCGCGATCCCT
TAGGGGGGGTCAGGGACGGCATTCGACTCGTCTCCCCCGCATCCGTCCCGGCGCTCGGAA
CGCCGCTCGACGCCTCCGGCTGTCGTCCCCGTCGTCGGTTTTGCGGGCAGCCGCCCGTTA
GGGTTTTCGTGGAGGACGAGAAGATAATCTGGTCCACGAATTGTTCCCCGAATCCAAAGC
CGCGGCCGTGGGGCCGAGCCAGAGCCGGCTCGGCGGCACTGGGAGATCAGGGTGCCTCTT
CGTTCTCCGTTTATACCGAGGACGCCGGGGCGCCGGCGAGGGTGAAGTCGCGGCTCACCG
CGTCCTCGGGCCCGTGTCACTGTGTCGGAGACTTCCCGCCTCACCCCGTCCTTTCCTTGG
GGTGTGATTGCTGCAGTTTCCGCCCGGTCCCCCTGGAGCAGACCTACGTGGGCATCACGG
AAAAGAAAGCTATCAAGCGTTTTCAGATCATGAACGAGATCGTCTACGAGAAGATCATGG
AACACGCGGGCAAGAATCAGGTTCGTCTCCCGCCCCCGGGCCGGTTCCGCCTTCCGCCGC
GGCCCCGACCCGGAGGGGTTGGACGCGGTCCGGCCCCCTGGTCCGTAGCGGGCCCGGGTC
CGGAGGTGGCTGCCGTCCACGCGCTCCGGGTCTTCTCGCGAGGGCGTAGACCGCCGGTGC
CAATCCCACGGGCCCCGGGGCCCTGGAGAAAAACGTCGGCCGGAACCCGCCCGCTTTCCC
CCTCAGGTCCTGGTGTTTGTCCATTCCCGGAAGGAGACGGGGAAGACGGCCAGGGCCATC
CGTGATATGTGCCTGGAGAAGGACACGCTGGGCCTGTTCCTGAGAGAGGGCTCCGCCTCC
ACCGAAGTGCTGCGCACGGAAGCCGAGCAGTGCAAGGTGACGGAGGGCCGGGCGGCCCGG
GCCGGGGCTCCCGTCCAGCGGACGGCCGGGGGGGGGGGCGGGGGCCGCGGGATCCGTCCG
CGTTCGCCGCGGAGGGGCGGCCGTGGGGCGAGAGGCGGCGAACGGGCGGCCGAGCCCGAG
GGAAGAACCCATCTGAGCGGGGTGGGGAGCCCTTGCCGGGCGCGTTCCCTGCCCGGATCC
CGTCGGCCAGTCGGCGACGTTTGCGGAGCGCCGGACCCAGCGCCGAGCACGGACCGGGAG
CACCGTGCGTCGGAGTGGGTAGACGCGGAGCCGAGGTGGGAAGGCAGGGCCTGCCTGACG
AGCTGTAACCCTTCTGTGCGGCAGAACCTGGAGCTGAAGGACCTCCTCCCTTACGGCTTC
GCCATTCACCACGCCGGGATGACCAGAGTCGACCGGACGCTCGTGGAGGATCTCTTCGCC
GACAAGCACATTCAGGTGAGGCGGGCGGAGAGCGGAGGCGGCGGTGGCCCGCGGAAGCCC
CGGGAGGTCGTCGCCTCGCTCCGGGCCGCGTGGGGCCTGTGTTCTCAAGCGACCTCGTTG
CCCGGTTCCCTCCTGTAGTCCCTCGATCCGTGGCTGGTATTTGTCGAGCGCGGACCCGGG
TGCCGAGCGCCGTACTGAGTTAAGGGCTTATTACGTGCCGGGCACCGTCCCGAGCACTGG
TGTAGCGAACAGGGCGTGGGCCCGGGGGTCAGAAGGTCCCGGGTTCTAACCCCAGCTCCG
CCGCGCGTCCGCCCTGTGAACTTGGGCGCTTCTCTGCTGCGCCTCAGTCGCCTCATCTGT
AAAACAGAGACCGAGACGCTCAGCGCCTGCCCCCCCCTCCCCCCCCCCCCCCCGGGACGG
GGACTCTGCCCAACCCGGTCGCCCGATTCCGGTGTCCGACGCGTAGCGAGCGCTTAACAA
ATACCATAGATCTCATTACGAGGTAATCGGGTCGGACTCGGTCCCCGTCCCAAACAGCGC
TCAGAGCGGTAACGACACCGAGGCGCGGAGAGGTCACGCGCGGAAGCCGAGCAGCGGAGC
CGGGATTGGAACAACCCGGGTCCTCTGACTGCCAGGCCCCGGGCTCGTTCCACCGGGCCA
CGCTGCTTCTCAAGGGAAGCGCGCTGCTCGGCCGAGGACAGGGTGGGTAGACACGATCCC
GACCCACAGGGAGCCGGATCTTTTAGCATCCCGAGGATCGGGCGGGATTCTGGCCCTGAG
GGCTGAGCGGGGGCGAGAGGGGACACCGGGAGGGAGGGCCGGCTCCTCCCCGCGTCTCTG
CAGGGAAAGAATCCTTCGCTCTGCGGAGACCGCGTCTCCCGGGGAGGTGTGAGTGCCAGA
TTTCCCCGGCGGTCAGGAAGTCGGAGATGGCCTCCCGGGTTGCGTCCCGTCTCCCCGGGC
CTCCGCGGCCCCAAATCGTCCGGTCTCGGCCCCGCAGGTTCTGGTCTCCACGGCAACTCT
GGCCTGGGGCGTGAACCTCCCCGCGCACACCGTCATCATCAAGGGCACGCAGGTGTACAG
TCCGGAGAAGGGGCGCTGGACAGAGCTGGGGGCCCTGGACATCCTGCAGGTACCGGCCTC
CCAACCGCCGGCGGCCAGGGCCGGGGACCCTCAGGGAGGCCCGAGGCGGGCGGGCGGAAG
GGATGCGCGCTCGGTTTCGGGCCGAGCTCGACCCGTCGTCTCCGGGTGCAGATGCTGGGC
CGGGCAGGGCGACCGCAGTACGACACCAAAGGCGAGGGCATTCTCATCACCTCGCACGGA
GAGCTCCAGTACTACTTGTCGCTGCTCAATCAGCAGCTGCCCATCGAGAGCCAGATGGTC
TCCAAGCTCCCCGACATGCTCAACGCGGAGATCGTGCTGGGGAACGTCCAGAACGCCAAG
GTGGGCGCCCGGCTCCCCCGGCCCCCTTCCCCCAGCCCGGGGAGACGTCCGGAGGAGCGG
GCGAGGGCGGACTCGGCCGTCGCCCGCAGGTGGAGCGGGCGGTCGCTCGGCGGTCTTTAC
CGAGCGCGCGCCGTGGGCACGGCCCTGCGCTGAGCCGTCGGGACCGGCCGGTCCGGTCGA
GGTGGGAGACGCGAACCCCGCCCTCGAGGGACCTACGGGGCCCCGGATCGCCAGAGCCCC
CGAGGATCCCTCTCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
562..771, 776..902, 2860..3006, 3056..3186, 3494..3767, 5085..5200, 5860..5943, 6036..6209, 6436..6579, 6643..6679, 8156..8229, 10674..10930, 11499..11692, 12376..12499, 12726..12875, 13224..13334, 14317..14448, 14571..14808
562..771, 776..902, 2860..3006, 3056..3186, 3494..3767, 5085..5200, 5860..5943, 6036..6209, 6436..6579, 6643..6679, 8156..8229, 10674..10930, 11499..11692, 12376..12499, 12726..12875, 13224..13334, 14317..14448, 14571..14759
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved