Ornithorhynchus_anatinus Locus ENSOANG00000004333
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus ENSOANG00000004333
Ornithorhynchus_anatinus
ENSOANG00000004333
Contig26401
SNORA48, SNORA67
1841..1981, 5206..5339
8923
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGACGGAATGGAACCCGACG
GTGTCATCGAGGTGAGCCCCGGCCCTCCGCCTTGTAGATTCCAGCCTCCTTCGGGGCGGG
GAGCCCTTCTCCTAGTTGTATTGGACCATTTTCTCGCAGAGGGCTTGGCACAGCGGCCCC
CATCTTCTAAGCTTGCAGCAGATGCCATCGGTGGATCGGGGTGGATCGCCAAGGGGGTGG
CCCCTTGGCGGGGCGTCAGTAATCCCACGGGGCCTCACTTAGGACTTTTGACACTCCTCC
GACCCCCCCCCCCCCCCCAAATATGGGAACATTAACCCTATTGACGAGATTGGTGTGGTC
CACCACATAAGAGGTTAGCGTGGCTTTAGTTCTTGGAAGGCTTTTCTGGCTTCCCCGTGG
GCCGAGCTTTGGGGGGACTGTCTAACCAGAACCACTTTTTGCAGGGCGTTTTAAGTTATG
TGACTTATGGCCTCTCACGTCGACTGCTGTCTCTTTTCCTCCATCCCCATCCTCAGAGCA
ACTGGAACGAGATCGTGGATAGTTTCGATGACATGAACCTGTCCGAGTCTCTGCTCCGCG
GCATCTACGCCTATGGTTTCGAGAAGCCCTCTGCCATCCAGCAGCGAGCCATTCTTCCTT
GTATCAAGGGTGAGCCCCGGTGTTCCCCGAAACCCCCTGAGCGTCACTGTCTCCCCTGAA
ATTCAGAAAGACCCCTTAAAGGTCTTAGCCGAACCCTGCGGCGCTCACACGTGCTCTTTC
GTGGTAATTTATCTGAAGAGATGAGATCATCTGGTTCCGTTGCGTTCAGGATGTTCTCTG
CACCGTGATCTTTTGGTAAATGTCACGGACTGGTTTTCCCCCACCCCCGTCACTGGGTAA
AGAGGCGCCTGATTGGTGGTGCCAGTCTTATATCAGGCGGGGGCAGAGCAGCCCAGTCCC
TGTTCATCCCAGCCCAACGCCCCGGGTAGTGGCCGCGGCTGGTTCATGGCTCGGACACAT
CGAAGTCCCGTTCAACCTGCTCTCTTGCATTGTATTCATGTACACACAGTTGCACACTGT
CATGTTTTTGTCTGGCAAAAGTTATCACACTGTTCTCAAGACTCATTTTGGGCAGGGAGT
GTGGCTTTTTATATTTTCCAAGTGCTTAGTATAGTCTGCTACACACAGCGTTCACTAAAT
GCAATTGACTAACATTTTTGTAGTCCCCGCTGGCCTGGTCTGGTTCTCAACACCCTTACC
AGGGCAGCTTTCTTCTGTCCTCACCCGGTTCCCCGCTTTCCGGCCATCAGGTTACGATGT
GATCGCCCAGGCCCAGTCTGGGACCGGAAAGACCGCGACCTTCGCCATCTCCATCCTGCA
GCAGATCGAACTGGACCTCAAGGCCACTCAGGCCCTCGTCCTGGCTCCCACCCGAGAGCT
GGCCCAGCAGGTGGGTCCTGGGTGGCCGGTGGGGGGGTCTCCCCCATGAAGCGCGAGTCG
GTCGGGAAAGGGACCGGGCAGCCGGAGGTGGGCTAGCTCACGCATACGTTTTGTAATTGA
GTTTCACAGAAGTAAGCTACTCCTCCCCTTCCACGAAGCCCTCTCCGGGGACCCAACGGC
AAACCTGAACCTGGTTGGCCAGATGAAGTTTGGGAATCCCATCTCCTGNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCACCCCAAACAGACTACCTGGAGGTGGT
GTGAATTATCTGGGCTGCTCCCCCTGTGCCATCTCTAGGGGGGTACTGGATGGGAGCAGG
AGGGGTTCAACGCATGTGGGCCTTCACGTAGTTATTCCCTTTTAATAATAAATTATGGCC
TTGATTAGTGCACCGGTGGGGCTGGCACTGTGATAAGGCACAGGAGGTGGATACCAGCGA
CTTCTATCACTCTTTTCTCCTCGTTCTTAATTAGTAATCATCCCCCACGCGAGGATATGA
GCCCGGACGCCCCAGCCCACCCGGCCCGAGGAGGAGTTCTGCTCCCTGGGGCAGTCAGTG
GGGTCGGGGACTTCCCGGCGTGTGATCAGACCTGTGAAAGCTTAGGAGAGCTACCTCCCG
CCCCCCCCCCCCCAAGCTCGTCCGTCTCGTCCGTTCCGACACCACCAAGCTGACTCTCCC
ACACCCTCCTTTTCCCCGCAGCCCCCAAGTACATCAAGATGTTCGTGCTGGACGAGGCCG
ATGAGATGTTGAGCCGCGGCTTCAAGGACCAGATCTACGACATCTTCCAGAAGCTGAGCG
GCAACACCCAGGTGAGGGGGTGGGGGGCGGTCCTGCTGTGGGGAGGAGTTGGGGGGCCAC
GCCCCTCGAAGCCCGGCCTCACGATGGGGGTCTCCTGGCGCAGGTGGTGCTGCTGTCGGC
CACCATGCCCTCGGACGTGCTGGAGGTCACCAAGAAGTTCATGCGGGACCCCATCCGTAT
CCTGGTGAAGAAGGAGGAGCTGACCCTGGAGGGTATCCGCCAGTTCTACATCAACGTGGA
ACGCGAGGTGGGTTCCGGTCATCGCTACCCCTGACTCCCGGGCGGCGCCGGCCGGCAGAT
TTGAAAGCCCGCCTCCTCTCCTCTTCCCCAGGAGTGGAAGCTGGACACTCTTTGCGACCT
GTATGAGACACTCACCATCACCCAGGCCGTCATCTTCATCAACACCCGCCGGAAGGTGGA
TTGGCTGACAGAGAAGATGCACGCCCGGGACTTCACCGTCTCCGCCATGGTGAGCCGCTG
AAAGGGTGAGCCCCTTTCCCTCCCGCTCCCGGCTCTCGCCCCTCAACTCAACCAATTGCT
TCCTCTCTCCCTCGTCTCTCCCAGCACGGCGACATGGACCAAAAGGAGCGAGACGTGATC
ATGCGGGAGTTCCGTTCGGGGTCCAGTCGGGTGCTCATCACCACCGACCTGCTGGTCAGT
GCCGGGCGGGCCCGGGGGGATGCATGCAGCCCAGGGGGAGGGGCGGGGCCAAGGAGATTC
CCTCTCCCGGGGGCCGCGCCGTGCCCCTTCTGGAACGTAGCTCCTTGGTAGAGCAGCGAG
CGGGCTCATGGGGGAAAGGGCCTGATGTCGCCCCTCCCCGTCATTCACGCCCCCACATGC
CTCATTTCCCCCCACCTTTCCCCCCACCTTGCCCGAGCCCGTGCCGACCCAACCCTTCCT
TTCCTTCTCCAGGCGAGAGGCATCGATGTGCAGCAGGTGTCCTTGGTCATCAACTACGAC
TTGCCCACCAATCGGGAGAACTACATCCACAGGTGAGCAAGCGGGATGAGCCACGGCCCC
CCATCTTACCTCCCCGCCTCGGGCCCCCCGTCCCTCACGTCCCCCGGCCTCCTCTCTCCC
GTTCAGAATCGGCCGTGGGGGCCGCTTCGGCCGCAAGGGCGTCGCCATCAACATGGTGAC
GGAGGAGGACAAACGGACCCTGCGGGACATCGAGACCTTCTACAACACCTCCATCGAGGA
GATGCCTCTCAACGTGGCCGACCTGATCTGAGGCCCCGGCCCGGCCCACCCCCCGCCGCC
ACCGATGCCCGAGGGCCCAAAGGGGCCAGAGATCCAACAGGCTGGCAGCTGGGCGAGCGG
GAGGGAGGGAGGGAGAGGGAGGAAGACAAGGGGCCAGCGGAGGCGGGGACCTTTGTCAAC
TTTTTTTTTTTTTTTTGACTTTGAATAAAATGTCACTTTTTGAGGCAAAAAGAAGGAAGC
ATGAAAGCTTCAANNNNNNNNNNTCTCTTCCTCCCCACCCCCGACCGCCTCCACTCCCCC
CAGGCCCTTTAAACTCCCTTTCCCCGGCCCCAAGGCAGCCTTCTCGATTCCCTTTAGGCC
CCAGATGAAGGGTGTGACTTGTCTTAGGTCCCCAAATCTCATGACCCCTGACTGGGTGTG
TGAAAAGGGGAAGTGCGTCGCGGGGAGGGGTGGCTGAGCAGCGCTGGGTGGGGCGGGTCG
GTGAGGGGCTCCCACGGGTGCTCCTCCCCCTGCCCCTCCCCTGCCTGTCCTCGCTGTGTG
CAGGTCCCCCCACCTCGTCAGCTGCTCCTGAGTCACTGCCCATGCGAGGAGCAGAGGTGG
CTGAGTCAGGAGCCCGGGGGGTTGGGGCTGGGGTCTGGACGGGAGGGAGTTTCGTTTCCG
CGAATATCCCAAAAAAGTGGAACTAAGGGGTGGGGAGATAGGGAGCCACCGGGCGGCCGG
CGGCAGCGGCTTGGGCAGACGGAGCCCGGCGGTCGGCGGAGAAGGAAGCCCAGCTCGACA
CCGCTTCCCCGAACATGCGGCCCTCCCCGGCCTTCCTGTTCTGGGGGGCCGCGCTGGTCC
TGGGGCTGCCGACAGGTACCGGCCGGGGCCCGGGACCCTCCTCCTCTGGGGGAACGGACC
GCTGGGGGGCTGCCTGCAGGTCACGGGGGTCGCGGCCGCTCCCGGGGGAGCCCGTTTGGG
GCTGAGGGGGGCGGGGTGGGGTGAGGAGTGGAGAGGGGGGCGGGGATGGGGGGGAAGGAG
GTAGGGACCCCTCTGGGAGGGACCTCTCCATGGGGCTGACCCTTCCCCTTCCAGCCCAGG
GCTCCCAGTGCAGGGCCAACTGTCCCCACAAAAAGTCAGCCACCCTGGTGCCATCCTTTA
CCGTGACGCCCACGGCGACCAGCGGCCCCACCACCACGGCGCATCAGACCACCACTGACC
ACGGCACCACCACCAGCCACGAGACCACTACTAGTCAGGGGACCAGCACGCCTCACACCA
CCACCACCGGCCACCAGACCACTAGCCACGGTTCCAGCACGCCTCACACCACCACCGGCC
ACCAGACCACTAGTCACAGGACCAGCACGCCTCACACCACCACCACCACCGGCCACCGGA
CCACCAGTCACAGGACCAGCACGCCTCACACCACCACCACTTTTTTTTTTGGACCACCAC
CGGCCACCGGACCACTAGTCACGGGACCAGCACGCCTCACACCACCACCACCGGCCACGG
GACCACCACCGGCCACCAGAACACCAGTCACAGTACTACCACTAGTCACGGGACCAGCAC
GCCTCACAAAACGACCACCAGACACCCAACCACCAGCCATGGGACCACCACTAGTCACGG
GACCAGCACTGGGCACTGGACCGCCAGGCCCACCATCCGGCCCGGGCCGCCCCCGCCCCC
TCCGAGCCCCGGGAAGGCCGTGGGCAACTACACCGTCTTCAACGGCTCCCAGCCCTGCCT
GCGTCTTCGGGCCGAAATCCGGCTCTGGGTCTTGTACCAGGCCCAGGAAGAAGGGGAGGT
GCAGAGGGTGGGGGTGAGGTTGGGGGAACTGTGGGGGCAGGGAGGAAGCCGGGGTGGGTG
GGGGGCGGGGATGGATGGACTGAGGCGGTTAATGAGGAAGGGAAGGGGCAGGGTGGGGCC
TAAGCCTAACCTAACCCTCTCTCCTCTCTCCCAACTTCCTCCTCCGGTCCTCTGCCTGCT
GGGCCTCCCTCCCCCTCCCTGTCTGTCTCTCTGATCCTCTGCCCCCGTGCCTTGCACCCC
TCTGCCCTCCCTCCCTCTGGATGCCCCCCGCCAGGGGCCCCGCCGTCTCTGGGGCAGCAT
GGTCCTGTCACCCAAAAGCACGAACGTGTCGGGGAGCTGTGAGGGGTTCAGCAGCAATCT
GGAACTTTCCTTCCCCCAAGGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1030, 1496..1628, 2270..2409, 2447..2511, 2529..2611, 4401..4510, 4603..4746, 4831..4968, 5064..5153, 5412..5491, 5586..6554, 6774..7882
1001..1030, 1496..1628, 2270..2409, 2447..2511, 2529..2611, 4401..4510, 4603..4746, 4831..4968, 5064..5153, 5412..5491, 5586..5730
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved