Ornithorhynchus_anatinus Locus Mono:SNORA38
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SNORA38
Ornithorhynchus_anatinus
Mono:SNORA38
Contig253251
SNORA38
264..366
461
GCTCTCCCCTCGGCGGCCCAGTCGCCCCCCGCCATGGCCTGCAGAGTCTCGGCAAAGTC
GCCATTGCCCGGCGCATGCCACCCCCAGCCAACCTGCCAAGCCTGAAAGCCGAGAACAAA
GGCAATGACCCCAACGTCTCGCTAGTGCCCAAAGACGGAACAGGATGGGCAAGCAAACAG
GAGCAGACCGACCCCAAGAGGTATCCCCGGCGGAGGTGTGGGGCACGAGGGAGGGGCGGT
GGCGGGTGGGCGCTCCGGTCCGGCCCCTCCCGCAAAGGCGCGTCCGATACTCCCGTGCCC
AGACGCGTAAGAACCGGAGGTAGAGAGATGGGCTGAGGGGCTTATTGAACTGGCTCCCCC
CTGATTGTTTCTATTGTTTCCCTTTTCTTTGTCTATGTTTTCTTGTGTTTTTTACCTTCA
CTTTTTTTTTTAATGTCTTTGTGCATAAAAATACTAACAAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved